Oxidative Medicine and Cellular Longevity / 2011 / Article / Tab 1

Research Article

Role of Reactive Oxygen Species in the Neural and Hormonal Regulation of the PNMT Gene in PC12 Cells

Table 1

The following primer sets were used for PNMT and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

GeneSpeciesAccession numberPrimer sequence (5′–3′)AmpliconNo. of cyclesAnnealing temp. (°C)

PNMTR. norvegicusX75333CAGACTTCTTGGAGGTCAACCG422 bp, 312 bp3558
(forward)
AGCAGCGTCGTGATATGATAC
(reverse)

GAPDHR. norvegicusBC059110ATGGTGGTGCTGAGTATGTCG475 bp2158
(forward)
CATGTCAGATCCACAACGGATAC
(reverse)

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.