Role of Reactive Oxygen Species in the Neural and Hormonal Regulation of the PNMT Gene in PC12 Cells

Table 1

The following primer sets were used for PNMT and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Gene	Species	Accession number	Primer sequence (5′–3′)	Amplicon	No. of cycles	Annealing temp. (°C)
PNMT	R. norvegicus	X75333	CAGACTTCTTGGAGGTCAACCG	422 bp, 312 bp	35	58
			(forward)
			AGCAGCGTCGTGATATGATAC
			(reverse)
GAPDH	R. norvegicus	BC059110	ATGGTGGTGCTGAGTATGTCG	475 bp	21	58
			(forward)
			CATGTCAGATCCACAACGGATAC
			(reverse)