Oxidative Medicine and Cellular Longevity / 2013 / Article / Tab 1

Research Article

Oxidative Stress and Mitogen-Activated Protein Kinase Pathways Involved in Cadmium-Induced BRL 3A Cell Apoptosis

Table 1

The primers for real-time PCR.

GenePrimers (5′-3′)

BaxSense: TTGTTACAGGGTTTCATCCAGG
Antisense: GTGTCCACGTCAGCAATCATC
Bcl-2Sense: GGGAGCGTCAACAGGGAG
Antisense: AGCCAGGAGAAATCAAACAGA
β-ActinSense: CGTTGACATCCGTAAAGAC
Antisense: TGGAAGGTGGAGTGAG