Table 1: Primer sequences used in real-time PCR experiments.

NameSequence (5′-3′)

BaxForwardAAGCTGAGCGAGTGTCTCAAGC
363 bpReverseCGCCACAAAGATGGTCACG
Bcl-2ForwardGTACATCCATTATAAGCTGTCGCAG
363 bpReverseAAGAGCTCCTCCACCACCGT
Caspase-3ForwardAGCACTGGAATGACATCTCGGT
350 bpReverseGTCTCAATGCCACAGTCCAGTTC
Caspase-9ForwardCTACGAGAACGATGACGAGTGCT
237 bpReverseCTCTCGAGGAAGGCCACGTA
-actinForwardGGGTCAGAAGGATTCCTATG
237 bpReverseGGTCTCAAACATGATCTGGG