Table 1: Sequences of primers used in real-time RT-PCR.

GeneSequence 5′-3′Amplicon length (bp)Accession number

p21F: AGAAGAGGCTGGTGGCTATTT169NM_001220777.1
R: CCCGCCATTAGCGCATCAC
p53F: AGATAGCGATGGTCTGGC381NM_001126118.1
R: TTGGGCAGTGCTCGCTTAGT
Bcl-2F: ATCGCCCTGTGGATGACTGAG129NM_000633.2
R: CAGCCAGGAGAAATCAAACAGAGG
BaxF: ACCAAGAAGCTGAGCGAGTGTC365XM_011527191.1
R: ACAAAGATGGTCACGGTCTGCC
SIRT1F: ACAGGTTGCGGGAATCCAAA155NM_001314049.1
R: GTTCATCAGCTGGGCACCTA
FGFR-1F: CCGCCCAACTTTTCCTCCAA511XM_006716314.1
R: AGGTGGCATAACGGACCTTG
GLUT-4F: CTCTGAGTTGAGGGCAAGGG3734XM_011523750.1
R: GGGGGACCTACCGCAACATA
TET2F: GAGACGCTGAGGAAATACGG258NM_001127208.2
R: TGGTGCCATAGGAGTGGACA
TET3F: CAGACCGCTGTGATCGTCAT263NM_001287491.1
R: AACTTGCGAGGTGTCTTGCT
GAPDHF: GTCAGTGGTGGACCTGACCT256NM_001289746.1
R: CACCACCCTGTTGCTGTAGC

F: sense primer; R: antisense primer; bp: base pair.