Table 2: Sequence to analyze primers for CpG methylation analysis.

GenePrimerSequence (5′-3′)Size (bp)GC%

Dnmt1FWBiotin - GTA GGT TGT AGA AGA TAG AAT AGT TTT GA2931
RWCCC ACT CTC TTA CCC TAT ATA ATA CAT2737
SeqCCC CTC CCA ATT AAT TTC1844.4

Sequence ID: gb|AH009208.2|
Dnmt1: at reverse strand of chromosome 9: 20907205–20959888 (52684 bp).

Sequence to analyze7104 – CGCGCGCGCGAAAAAGCCGGGGTCTCGT - 7131277 CpGs

MLH1FWAGG GTA TTT TAG TTT TTA TTG GTT GGA GA2931
RWTTA CAC CTC AAT TCC TAA AAT CTC TAT CCC – Biotin3037
SeqTTT AGT TTT TAG AAA TGA GTT AAT A2516

Sequence ID: ref|XR_379849.3|
MLH1: at reverse strand of chromosome 9: 111228228–111271786 (43559 bp)

Sequence to analyze19 - GAAGAGCGGACCGTGAACTTTGACGCGCAAGCGCG 648 CpGs
TTGCCTTCTA-GCCTGGTGTCGGGCCGCTG - 82