Oxidative Medicine and Cellular Longevity / 2017 / Article / Tab 1

Research Article

Resveratrol Prevents ROS-Induced Apoptosis in High Glucose-Treated Retinal Capillary Endothelial Cells via the Activation of AMPK/Sirt1/PGC-1α Pathway

Table 1

Primer details.

PrimeForward (5-3)Reverse (5-3)Amplicon size (bp)

Sirt1CCCTGAAAGTAAGACCAGTAGCACACAGCAAAGTTTGGCATATTCAC182
PGC-1αCACTCTTCCACAGATTCCGACCGACTGGGATGACCGAAGTGC142
β-ActinTCCTGCGTCTGGACCTGGTGATGTCACGGACGATTTCC114

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.