Oxidative Medicine and Cellular Longevity / 2017 / Article / Tab 1

Research Article

Pitaya Extracts Induce Growth Inhibition and Proapoptotic Effects on Human Cell Lines of Breast Cancer via Downregulation of Estrogen Receptor Gene Expression

Table 1

Primer sequences for the reverse transcription-quantitative polymerase chain reaction.

GeneForward primerReverse Primer

ERBB2CCGTGCCACCCTGAGTGTAGCCTCCGGTCCAAAACAG
GSTM1TCCCTCTTCACTCCCCCTAAAGGGTAGCTGAGGCTTCAAAGG
BRCA1CTGCTCAGGGCTATCCTCTCATGCTGGAGCTTTATCAGGTTATGT
BRCA2CCACAGCCAGGCAGTCTGTATAGAACACGCAGAGGGAACTTG
PRBCCTGAAGTTTCGGCCATACCCAGGGCCGAGGGAAGAGT
PRABGGCTACGAAGTCAAACCCAGTTCAATTGCCTTGATGAGCTCTCTAA
ERαCTGTTTGCTCCTAACTTGCTCTTGTCCACCATGCCCTCTACACA
GAPDHATGGAAATCCCATCACCATCTTCGCCCCACTTGATTTTGG

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.