Oxidative Medicine and Cellular Longevity / 2018 / Article / Tab 1

Research Article

Mesenchymal Stem Cells from Cervix and Age: New Insights into CIN Regression Rate

Table 1

Primer sequences.

Gene symbolForwardReverse

GAPDHAGCCACATCGCTCAGACACGCCCAATACGACCAAATCC
RPLP0CCATTCTATCATCAACGGGTACAATCAGCAAGTGGGAAGGTGTAATC
NANOGTGAACCTCAGCTACAAACAGCTGGATGTTCTGGGTCTGGT
SOX2ACACCAATCCCATCCACACTGCAAACTTCCTGCAAAGCTC
OCT4AGCGAACCAGTATCGAGAACTTACAGAACCACACTCGGAC
KLF4CCCACACAGGTGAGAAACCTATGTGTAAGGCGAGGTGGTC
cMETTACCACTCCTTCCCTGCAACTCATTGCCCATTGAGATCAT
cFOSAGAATCCGAAGGGAAAGGAACTTCTCCTTCAGCAGGTTGG
cJUNTAACAGTGGGTGCCAACTCACCAAGTCCTTCCCACTCGT
mKi67ACAGAAAAATCGAACTGGGAAAGTTTATGAAGCCGATTCAGACC
MMP11TCTCGTGGGTCCTGACTTCTGTTGTCATGGTGGTTGTACCC
VEGFCCTCCGAAACCATGAACTTTATGATTCTGCCCTCCTCCTTCT
CXCL12TGAGAGCTCGCTTTGAGTGACACCAGGACCTTCTGTGGAT

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.