Oxidative Medicine and Cellular Longevity / 2018 / Article / Tab 1

Research Article

Protective Effects of Different Kinds of Filtered Water on Hypertensive Mouse by Suppressing Oxidative Stress and Inflammation

Table 1

Sequences of the primers used for PCR [15, 16].

GenesForward primerReverse primer

IL-6TAGTCCTTCCTACCCCAATTTCCTTGGTCCTTAGCCACTCCTTC
TNF-αCCCTCACACTCAGATCATCTTCTGCTACGACGTGGGCTACAG
IL-1βGCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCAACT
NF-κB P65ATGATCGCCACCGGATTGAGAGTTTCGGGTAGGCACAGCA
GAPDHAGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA