Research Article

Chlorophyll-Mediated Changes in the Redox Status of Pancreatic Cancer Cells Are Associated with Its Anticancer Effects

Table 1

Sequences of the primers for the target genes.

GenesGenBank accession numberForward primerReverse primerFragment (bp)

HMOX1NM_002133.2GGGTGATAGAAGAGGCCAAGAAGCTCCTGCAACTCCTCAAA67
BLVRANM_000712.3TCCCTCTTTGGGGAGCTTTCGGACCCAGACTTGAAATGGAAG180
HPRTNM_000194.2CACTGGCAAAACAATGCAGACGGGTCCTTTTCACCAGCAAG92

HMOX1: heme oxygenase 1; BLVRA: biliverdin reductase; HPRT: hypoxanthine phosphoribosyltransferase 1. HPRT was used as the housekeeping gene. Two reference genes (HPRT and GAPD) were selected as the most stable among 4 constant genes (HPRT, GAPD, 18S RNA, and UBC) based on the analyses of peripheral blood leukocytes and the DNA of 10 healthy human controls by using geNORM 3.5 (https://genorm.cmgg.be/, accessed 2009 Dec 15). Based upon similar expression levels as in target genes, HPRT was selected as a more appropriate control gene, compared to GAPD.