Table 1: Primers for quantitative polymerase chain reaction.

GeneForward primer (5-3)Reverse primer (5-3)

TRPA1GTCCAGGGCGTTGTCTATCGCGTGATGCAGAGGACAGAGAT
IL-1βGGGCCTCAAAGGAAAGAATCTACCAGTTGGGGAACTCTGC
IL-6CCAAGAGGTGAGTGCTTCCCCTGTTGTTCAGACTCTCTCCCT
IL-17TTTAACTCCCTTGGCGCAAAACTTTCCCTCCGCATTGACAC
TNF-αGACGTGGAACTGGCAGAAGAGTTGGTGGTTTGTGAGTGTGAG
GAPDHAACTTTGGCATTGTGGAAGGCACATTGGGGGTAGGAACAC