Oxidative Medicine and Cellular Longevity / 2019 / Article / Tab 1

Research Article

Methylene Blue-Mediated Photodynamic Therapy Induces Macrophage Apoptosis via ROS and Reduces Bone Resorption in Periodontitis

Table 1

Primers used for real-time PCR.

GenesForward primer 5-3Reverse primer 5-3

GAPDHACA GCA ACA GGG TGG TGG ACTTT GAG GGT GCA GCG AAC TT
TNF-αGACCCTCACACTCAGATCATCTTCTTGCTACGACGTGGGCTACG
IL-1βGCACAGTTCCCCAACTGGTAAAGACACGGGTTCCATGGTG

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.