Research Article
Upregulation of miR-34a by Inhibition of IRE1α Has Protective Effect against Aβ-Induced Injury in SH-SY5Y Cells by Targeting Caspase-2
Table 2
Oligonucleotide primer sets for real-time PCR.
| Name | Sequence (5–3) | Length | Tm | Size |
| miR-34a F | GATCGATGGCAGTGTCTTAGCT | 22 | 58.7 | 62 | miR-34a R | GTGCAGGGTCCGAGGTATTC | 20 | 59.2 | | U6 F | CTCGCTTCGGCAGCACA | 17 | 60.4 | 94 | U6 R | AACGCTTCACGAATTTGCGT | 20 | 59.7 | |
|
|