Oxidative Medicine and Cellular Longevity / 2019 / Article / Tab 2

Research Article

Upregulation of miR-34a by Inhibition of IRE1α Has Protective Effect against Aβ-Induced Injury in SH-SY5Y Cells by Targeting Caspase-2

Table 2

Oligonucleotide primer sets for real-time PCR.

NameSequence (5–3)LengthTmSize

miR-34a FGATCGATGGCAGTGTCTTAGCT2258.762
miR-34a RGTGCAGGGTCCGAGGTATTC2059.2
U6 FCTCGCTTCGGCAGCACA1760.494
U6 RAACGCTTCACGAATTTGCGT2059.7

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.