Oxidative Medicine and Cellular Longevity / 2019 / Article / Tab 2

Research Article

Inhibition of Mitofusin-2 Promotes Cardiac Fibroblast Activation via the PERK/ATF4 Pathway and Reactive Oxygen Species

Table 2

Primer sequences and amplicon sizes for real-time RT-PCR.

GenesPrimer sequence (5-3)

COL-1F: 5ACGTCCTGGTGAAGTTGGTC3
R: 5TCCAGCAATACCCTGAGGTC3
CTGFF: 5CAGGGAGTAAGGGACACGA3
R: 5ACAGCAGTTAGGAACCCAGAT3
α-SMAF: 5CCGAGATCTCACCGACTACC3
R: 5ATGCCACAGGATTCCATACCC3
Mfn2F: 5CACTTGTCTTCCCCAATGAG3
R: 5GGAGAGGAAACCUGAC3
β-ActinF: 5CCUCUCCUUUGGACUGUAU3
R: 5ATGCCACAGGATTCCATACCC3
TGF-β1F: 5TGAGTGGCTGTCTTTTGACG3
R: 5ACTGAAGCGAAAGCCCTGTA3
ATF4F: 5TGGAGUGACCGCUCACAUUU3
R: 5CCUCACUGGCGAGUGUAAA3

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.