Oxidative Medicine and Cellular Longevity / 2019 / Article / Tab 1

Research Article

Antiobesity, Regulation of Lipid Metabolism, and Attenuation of Liver Oxidative Stress Effects of Hydroxy-α-sanshool Isolated from Zanthoxylum bungeanum on High-Fat Diet-Induced Hyperlipidemic Rats

Table 1

Sequences of primers used in qRT-PCR.

GenesGenBank numberFragment length (bp)

Gapdh
 F:CTGGAGAAACCTGCCAAGTATGNM_017008.4138
 R:GGTGGAAGAATGGGAGTTGCT
Apoe
 F:TGACGGTACTGATGGAGGACACTNM_001270681.1201
 R:CCAGCATGGTGTTTACCTCGTT
Pparg
 F:CCCTTTACCACGGTTGATTTCNM_001145366.1321
 R:CTTCAATCGGATGGTTCTTCG

F: forward; R: reverse.

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.