Oxidative Medicine and Cellular Longevity / 2019 / Article / Tab 1

Research Article

Myricetin Alleviates Pathological Cardiac Hypertrophy via TRAF6/TAK1/MAPK and Nrf2 Signaling Pathway

Table 1

Primers used for RT-PCR.

Gene symbolGenusSense-forward primerAntisense-reverse primer

ANPMouseACCTGCTAGACCACCTGGAGCCTTGGCTGTTATCTTCGGTACCGG
BNPMouseGAGGTCACTCCTATCCTCTGGGCCATTTCCTCCGACTTTTCTC
α-MHCMouseGTCCAAGTTCCGCAAGGTAGGGTCTGCTGGAGAGGTTA
β-MHCMouseCCGAGTCCCAGGTCAACAACTTCACGGGCACCCTTGGA
TGF-βMouseTGCGCTTGCAGAGATTAAAACGTCAAAAGACAGCCACTCA
Collagen IMouseAGGCTTCAGTGGTTTGGATGCACCAACAGCACCATCGTTA
Collagen IIIMouseCCCAACCCAGAGATCCCATTGAAGCACAGGAGCAGGTGTAGA
GAPDHMouseACTCCACTCACGGCAAATTCTCTCCATGGTGGTGAAGACA
ANPRatAAAGCAAACTGAGGGCTCTGCTCGTTCGGTACCGGAAGCTGTTGCA
BNPRatTTCCTTAATCTGTCGCCGCTGGCAGCAGCTTCTGCATCGTGGAT
β-MHCRatTCTGGACAGCTCCCCATTCTCAAGGCTAACCTGGAGAAGATG
GAPHDRatGACATGCCGCCTGGAGAAACAGCCCAGGATGCCCTTTAGT