Oxidative Medicine and Cellular Longevity / 2019 / Article / Tab 1

Research Article

S. Giovanni Varieties (Pyrus communis L.): Antioxidant Properties and Phytochemical Characteristics

Table 1

Primers amplifying pear SSR chosen for fingerprint analysis.

PrimerRepeated motifForward (5-3)Reverse (5-3)bp

EMPc108(CA)26TGAGTGGGCTTTTGGTTTTCTCCATTTAAACACATTTTCTGGA122
NH002b(GA)12GGAGTCAGCGGCAAAAAAAGCCCACTCCCTCCTCTTATTGT180
NH029a(AG)8GAAGAAAACCAGAGCAGGGCACCTCCCGTCTCCCACCATATTAG91-196
TXY11(TC)8CAGAATTCAACATTCACTCTCTCTCGAGTAGGGATGTGTCGGCTC120-166
TXY86(AG)8TTGGGTCTTTAAATGCCAGCCCAGACGTGAGTTGTTGCC114–156
EMPc01(GT)17AGTTTGGTATTGTGGAGGGTCTTAGTCTTTTGGGTGGCTGAACA135–197
EMPc11(AC)13GCGATTAAAGATCAATAAACCCATAAAGCAGCTGGTTGGTGAAAT121–161
EMPc110(CT)18ACTAACATTAAAAAATCTTTACATCTTAAAACTTAAACTAAATAA157–199
EMPc114(AG)20GTACCCACAATTCCCCATATGCCTTATGCGCCTTCTACC152–169
NB131a(GAA)4GAGACCAAACAAAGCTGCCGAACCCAACCCATCGAATCCC261

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.