Oxidative Medicine and Cellular Longevity / 2019 / Article / Tab 1

Research Article

Modulations of Histone Deacetylase 2 Offer a Protective Effect through the Mitochondrial Apoptosis Pathway in Acute Liver Failure

Table 1

Primers for RT-PCR.

GenesForward (5-3)Reverse (5-3)

HDAC2 (human)GCTACTACTACGACGGTGATATTGGTTCTTCGGCAGTGGCTTTATGG
bcl2 (human)CTGCACCTGACGCCCTTCACCCACATGACCCCACCGAACTCAAAGA
bcl2 (rat)GAGCGTCAACAGGGAGATGTCAGCCAGGAGAAATCAAACAG
bax (human)CGAGTGGCAGCTGACATGTTTTTGAGGCAGGTGAATCGCTTG
bax (rat)GAGCGAGTGTCTCCGGCGAATTGCCACAAAGATGGTCACTGTCTG
GAPDH (human)ACCACAGTCCATGCCATCACTCCACCACCCTGTTGCTGTA
GAPDH (rat)GGCACAGTCAAGGCTGAGAATGATGGTGGTGAAGACGCCAGTA

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.