Research Article

Cornelian Cherry Iridoid-Polyphenolic Extract Improves Mucosal Epithelial Barrier Integrity in Rat Experimental Colitis and Exerts Antimicrobial and Antiadhesive Activities In Vitro

Table 2

Primers’ sequences.

SymbolGene nameAccession no.Primer sequence 5 ⟶ 3Amp. size (bp)

GapdhGlyceraldehyde-3-phosphate dehydrogenaseNM_017008.4F: tgactctacccacggcaagttcaa141
R: acgacatactcagcaccagcatca
Tff3Trefoil factor 3NM_013042.2F: taaccctgctgctggtcctg195
R: gtttgaagcaccagggcaca
Stat3Signal transducer and activator of transcription 3NM_012747.2F: cgccttggattgagagccaagat112
R: aggaatcggctatactgctggt
Muc2Mucin 2XM_017604244.1F: accaccattaccaccacctcag119
R: cgatcaccaccattgccattg

Primer sequences were retrieved from the literature and validated in silico by BLAST analysis. Forward and reverse primer sequences are denoted by “F” and “R,” respectively. Amp.: amplicon; bp: base pairs.