Oxidative Medicine and Cellular Longevity / 2020 / Article / Tab 1

Research Article

Ameliorative Effect of Sinapic Acid on Dextran Sodium Sulfate- (DSS-) Induced Ulcerative Colitis in Kunming (KM) Mice

Table 1

The primer sequences used in this study for qRT-PCR.

Primer nameForward (5→3)Reverse (3→5)

Mouse TnfαATGAGCACAGAAAGCATGAAGTAGACAGAAGAGCGTGGT
Mouse Il1βAATGAAAGACGGCACACCCATGCTTGTGAGGTGCTGATGT
Mouse Il6CCTCTGGTCTTCTGGAGTACCACTCCTTCTGTGACTCCAGC
Mouse Il4GGTCTCAACCCCCAGCTAGTCCGATGATCTCTCTCAAGTGAT
Mouse Il18AAACCACCGGAAGGAACCATCTTCACACAGAGCTGCAGAAA
Mouse Il10GCTCTTACTGACTGGCATGAGCGCAGCTC TAGGAGCATGTG
Mouse Il17aTCTCCACCGCAATGAAGACCCACACCCACCAGCATCTTCT
Mouse IfnγTTCTTCAGCAACAGCAAGGCTCAGCAGCGACTCCTTTTCC
Mouse Claudin1ACGGCTCCGTTTTCTAGATGCCCGTTTGGCTGCTGCTCTTGC
Mouse Zo1CCATCTTTGGACCGATTGCTGTAATGCCCGAGCTCCGATG
Mouse OccludinACGGTCCTCCTGGCTCAGTTGATAAGCGAACCTTGGCGGC
Mouse GapdhCGGAGTCAACGGATTTGGTCAGCCTTCTCCATGGTCGTGA