PPAR<i>γ</i> Attenuates Interleukin-1<i>β</i>-Induced Cell Apoptosis by Inhibiting NOX2/ROS/p38MAPK Activation in Osteoarthritis Chondrocytes

<table class="table-group" id="tab1"><tr><td><table class="table"><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr class="thead"><td class="align_left">Gene</td><td class="align_center">Forward (<span class="nowrap"><svg height="11.6425pt" id="M2" style="vertical-align:-0.2063999pt" version="1.1" viewbox="-0.0498162 -11.4361 45.7364 11.6425" width="45.7364pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M153 550H386L412 615L406 623H120L82 318C104 327 142 338 184 338C294 338 347 275 347 187C347 112 305 39 221 39C160 39 119 71 97 89C88 97 80 96 71 90C59 80 50 67 49 57C48 45 52 36 66 23C80 9 123 -12 169 -12C221 -11 288 15 342 59C403 109 431 165 431 225C431 308 366 395 238 395C212 395 165 379 127 364L153 550Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,6.24,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g><g transform="matrix(.013,0,0,-0.013,13.668,0)"><path d="M567 230V280H69V230H567Z"></path></g><g transform="matrix(.013,0,0,-0.013,19.443,0)"><path d="M901 255C861 290 790 361 716 442L694 427L796 280H69V230H796L694 83L716 68C790 149 861 220 901 255Z"></path></g><g transform="matrix(.013,0,0,-0.013,35.555,0)"><path d="M285 378C315 398 338 416 353 432C373 451 384 474 384 503C384 579 325 635 236 635H235C182 635 136 610 108 579L65 516L85 496C110 533 150 575 205 575C258 575 300 543 300 481C300 407 232 369 141 339L147 310C163 315 188 321 211 321C268 321 338 284 338 192C338 94 288 40 217 40C160 40 119 68 93 91C85 98 77 97 69 91C60 84 47 71 46 58C44 46 48 35 62 22C75 10 116 -12 162 -12C234 -12 424 62 424 224C424 297 373 359 285 376V378Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,41.795,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>)</span></td><td class="align_center">Reverse (<span class="nowrap"><svg height="11.6425pt" id="M3" style="vertical-align:-0.2063999pt" version="1.1" viewbox="-0.0498162 -11.4361 45.7364 11.6425" width="45.7364pt" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink"><g transform="matrix(.013,0,0,-0.013,0,0)"><path d="M153 550H386L412 615L406 623H120L82 318C104 327 142 338 184 338C294 338 347 275 347 187C347 112 305 39 221 39C160 39 119 71 97 89C88 97 80 96 71 90C59 80 50 67 49 57C48 45 52 36 66 23C80 9 123 -12 169 -12C221 -11 288 15 342 59C403 109 431 165 431 225C431 308 366 395 238 395C212 395 165 379 127 364L153 550Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,6.24,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g><g transform="matrix(.013,0,0,-0.013,13.668,0)"><path d="M567 230V280H69V230H567Z"></path></g><g transform="matrix(.013,0,0,-0.013,19.443,0)"><path d="M901 255C861 290 790 361 716 442L694 427L796 280H69V230H796L694 83L716 68C790 149 861 220 901 255Z"></path></g><g transform="matrix(.013,0,0,-0.013,35.555,0)"><path d="M285 378C315 398 338 416 353 432C373 451 384 474 384 503C384 579 325 635 236 635H235C182 635 136 610 108 579L65 516L85 496C110 533 150 575 205 575C258 575 300 543 300 481C300 407 232 369 141 339L147 310C163 315 188 321 211 321C268 321 338 284 338 192C338 94 288 40 217 40C160 40 119 68 93 91C85 98 77 97 69 91C60 84 47 71 46 58C44 46 48 35 62 22C75 10 116 -12 162 -12C234 -12 424 62 424 224C424 297 373 359 285 376V378Z"></path></g><g transform="matrix(.0091,0,0,-0.0091,41.795,-5.741)"><path d="M310 541L304 571C290 586 211 619 185 610L80 76L131 52L310 541Z"></path></g></svg>)</span></td></tr><tr><td class="thead-hr" colspan="3"><hr/></td></tr><tr><td class="align_left">COX-2</td><td class="align_center">TGGCTTCGGGAGCACAAC</td><td class="align_center">CAGCGGATGCCAGTGATAGAG</td></tr><tr><td class="align_left">GAPDH</td><td class="align_center">GGAGTCTACTGGCGTCTTCAC</td><td class="align_center">ATGAGCCCTTCCACGATGC</td></tr><tr class="table-tr"><td colspan="3"><hr class="tbody-hr"/></td></tr></table></td></tr></table>

Oxidative Medicine and Cellular Longevity

tab1

Table 1

Table 1: PPAR<i>γ</i> Attenuates Interleukin-1<i>β</i>-Induced Cell Apoptosis by Inhibiting NOX2/ROS/p38MAPK Activation in Osteoarthritis Chondrocytes 

Oxidative Medicine and Cellular Longevity

PPARγ Attenuates Interleukin-1β-Induced Cell Apoptosis by Inhibiting NOX2/ROS/p38MAPK Activation in Osteoarthritis Chondrocytes

Table 1