PPAR Research / 2009 / Article / Tab 1

Research Article

Fasting Upregulates PPAR 𝛼 Target Genes in Brain and Influences Pituitary Hormone Expression in a PPAR 𝛼 Dependent Manner

Table 1

Characteristics of the specific primers used for RT-PCR analysis.

GeneForward primer (5 to 3)Reverse primer (5 to 3)PCR product size (bp)NCBI GenBank

β-Actin (rat)ATCGTGCGTGACATTAAAGAGAAGGGACAGTGAGGCCAGGATAGAG429BC063166
ACO (rat)CTTTCTTGCTTGCCTTCCTTCTCCGCCGTTTCACCGCCTCGTA415NM017340
CPT1A (rat)GGAGACAGACACCATCCAACATAAGGTGATGGACTTGTCAAACC416NM031559
CPT1C (rat)CATCTCCAGCAAGCAATCAAGATCCCCAATACCCCTGTCT299BC105882
LCAD (rat)AAGGATTTATTAAGGGCAAGAAGCGGAAGCGGAGGCGGAGTC380NM012849
MCAD (rat)CAAGAGAGCCTGGGAACTTGCCCCAAAGAATTTGCTTCAA154NM016986
Mitochondrial HMG-CoA synthase (rat)GGCCTTGGACCGATGCTATGCGGGAGGCCTTGGTTTTCTTGTTG323BC083543
PPAR (rat)CCCTCTCTCCAGCTTCCAGCCCCCACAAGCGTCTTCTCAGCCATG555NM013196
β-Actin (mouse)ACGGCCAGGTCATCACTATTGCACAGGATTCCATACCCAAGAAG87NM007393
ACO (mouse)CAGGAAGAGCAAGGAAGTGGCCTTTCTGGCTGATCCCATA189NM015729
LHβ (mouse)GTCCCAGGACTCAACCAATGGGGAGGGAGGGATGATTAGA110NM008497
Mitochondrial HMG-CoA synthase (mouse)CCTCTGTGAATCCTGGGTGTCTGTGGGGAAAGATCTGCAT141NM008256
POMC (mouse)GGGTCCCTCCAATCTTGTTTGCACCAGCTCCACACATCTA137NM008895
Prolactin (mouse)CTCAGGCCATCTTGGAGAAGTCGGAGAGAAGTCTGGCAGT174NM011164
FSHβ (mouse)AGGGAGGAAAGGAAAGTGGAAGCCAGCTTCATCAGCATTT202NM008045
GH (mouse)ACGCGCTGCTCAAAAACTATGCTAGAAGGCACAGCTGCTT120NM008117
TSHβ (mouse)TCAACACCACCATCTGTGCTTCTGACAGCCTCGTGTATGC239NM009432

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.