Synergism between cAMP and PPAR<svg     style="vertical-align:-3.636pt;width:11.1125px;" id="M1" height="15.0125" version="1.1" viewBox="0 0 11.1125 15.0125" width="11.1125"  xmlns:xlink="http://www.w3.org/1999/xlink" xmlns="http://www.w3.org/2000/svg">
	
		
			<g transform="matrix(.022,-0,0,-.022,.062,10.412)"><path id="x1D738" d="M377 450h126l-264 -401q0 -75 -21 -153q-12 -44 -36 -71t-56 -27q-27 0 -42 18.5t-15 42.5q0 34 30 89q9 16 32 50q21 31 29 46q13 91 13 208q0 45 -11 94q-11 47 -34 47q-38 0 -61 -81h-23q40 150 121 150q46 0 65 -34.5t19 -99.5q0 -54 -7 -125z" /></g>

		
	
</svg> Signalling in the Initiation of UCP1 Gene Expression in HIB1B Brown Adipocytes

<div class="floats-full-page floats-full-page-other"><h2>Table 1</h2><div class="floats-full-page-caption">The sequences of primers for the real-time PCR.</div><div class="floats-full-page-content"><table class="table-group" id="tab1"><tr><td><table class="table"><tr><td class="thead-hr" colspan="3"><hr /></td></tr><tr class="thead"><td align="left">Gene</td><td align="center">Forward primer</td><td align="center">Reverse primer</td></tr><tr><td class="thead-hr" colspan="3"><hr /></td></tr><tr><td align="left">PGC1<svg height="7.9499998" id="M41" style="vertical-align:-0.1638pt" version="1.1" viewbox="0 0 9.7749996 7.9499998" width="9.7749996" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink">
<g transform="matrix(.017,-0,0,-.017,.062,7.675)"><path d="M545 106q-67 -118 -134 -118q-24 0 -40 37.5t-30 129.5h-2q-47 -72 -103 -119.5t-108 -47.5q-47 0 -76 45.5t-29 119.5q0 113 85 204t174 91q47 0 70 -33.5t43 -119.5h3q32 47 80 140l55 13l10 -9q-47 -80 -138 -201q17 -99 27.5 -136t22.5 -37q23 0 69 61zM333 204&#10;q-14 98 -31 149.5t-50 51.5q-49 0 -94 -70t-45 -164q0 -55 15.5 -86t40.5 -31q70 0 164 150z" id="x1D6FC"></path></g>
</svg></td><td align="center">TGAGAGACCGCTTTGAAGTTTTT</td><td align="center">CAGGTGTAACGGTAGGTGATGAAA</td></tr><tr><td align="left">PRDM16</td><td align="center">TCTTACTTCTCCGAGATCCGAAA</td><td align="center">GATCTCAGGCCGTTTGTCCAT</td></tr><tr><td align="left">C/EBP<i>β</i></td><td align="center">AGCGGCTGCAGAAGAAGGT</td><td align="center">GGCAGCTGCTTGAACAAGTTC</td></tr><tr><td align="left">UCP1</td><td align="center">GCCATCTGCATGGGATCAA</td><td align="center">GGTCGTCCCTTTCCAAAGTG</td></tr><tr><td align="left">PPAR<i>γ</i></td><td align="center">GTGCCAGTTTCG ATCCGT AGA</td><td align="center">GGCCAGCATCGTGTAGATA</td></tr><tr><td align="left">aP2</td><td align="center">AACACCGAGATTTCC</td><td align="center">ACACATTCCACCACCAG</td></tr><tr><td align="left">Cidea</td><td align="center">ACAGAAATGGACACCGGGTAGT</td><td align="center">CGAAGGTGACTCTGGCTATTCC</td></tr><tr><td align="left">36B4</td><td align="center">TCCAGGCTTTGGGCATCA</td><td align="center">TTATCAGCTGCACATCACTCAGAAT</td></tr><tr class="table-tr"><td colspan="3"><hr class="tbody-hr" /></td></tr></table></td></tr></table></div></div>

Table 1 | Synergism between cAMP and PPAR<svg     style="vertical-align:-3.636pt;width:11.1125px;" id="M1" height="15.0125" version="1.1" viewBox="0 0 11.1125 15.0125" width="11.1125"  xmlns:xlink="http://www.w3.org/1999/xlink" xmlns="http://www.w3.org/2000/svg">
	
		
			<g transform="matrix(.022,-0,0,-.022,.062,10.412)"><path id="x1D738" d="M377 450h126l-264 -401q0 -75 -21 -153q-12 -44 -36 -71t-56 -27q-27 0 -42 18.5t-15 42.5q0 34 30 89q9 16 32 50q21 31 29 46q13 91 13 208q0 45 -11 94q-11 47 -34 47q-38 0 -61 -81h-23q40 150 121 150q46 0 65 -34.5t19 -99.5q0 -54 -7 -125z" /></g>

		
	
</svg> Signalling in the Initiation of UCP1 Gene Expression in HIB1B Brown Adipocytes

title

Table 1: Synergism between cAMP and PPAR<svg     style="vertical-align:-3.636pt;width:11.1125px;" id="M1" height="15.0125" version="1.1" viewBox="0 0 11.1125 15.0125" width="11.1125"  xmlns:xlink="http://www.w3.org/1999/xlink" xmlns="http://www.w3.org/2000/svg">
	
		
			<g transform="matrix(.022,-0,0,-.022,.062,10.412)"><path id="x1D738" d="M377 450h126l-264 -401q0 -75 -21 -153q-12 -44 -36 -71t-56 -27q-27 0 -42 18.5t-15 42.5q0 34 30 89q9 16 32 50q21 31 29 46q13 91 13 208q0 45 -11 94q-11 47 -34 47q-38 0 -61 -81h-23q40 150 121 150q46 0 65 -34.5t19 -99.5q0 -54 -7 -125z" /></g>

		
	
</svg> Signalling in the Initiation of UCP1 Gene Expression in HIB1B Brown Adipocytes

description

Table 1 | Synergism between cAMP and PPAR
	
		
			

		
	
 Signalling in the Initiation of UCP1 Gene Expression in HIB1B Brown Adipocytes

Table 1

About this journal

<p><em>PPAR Research</em> publishes articles related to mechanisms involved in the activation of peroxisome proliferator-activated receptors, as well as their role in regulation of cellular differentiation, development, energy homeostasis and metabolic function.</p>


Journal profile

Meet the editorial board

<p><em>PPAR Research</em> maintains an Editorial Board of practicing researchers from around the world, to ensure manuscripts are handled by editors who are experts in the field of study.</p>


Editor spotlight

Submit to Special Issue

We currently have a number of Special Issues open for submission. Special Issues highlight emerging areas of research within a field, or provide a venue for a deeper investigation into an existing research area.

PPAR Research

Synergism between cAMP and PPAR Signalling in the Initiation of UCP1 Gene Expression in HIB1B Brown Adipocytes

Table 1