PPAR Research / 2013 / Article / Tab 1

Research Article

Synergism between cAMP and PPAR Signalling in the Initiation of UCP1 Gene Expression in HIB1B Brown Adipocytes

Table 1

The sequences of primers for the real-time PCR.

GeneForward primerReverse primer

PGC1 TGAGAGACCGCTTTGAAGTTTTTCAGGTGTAACGGTAGGTGATGAAA
PRDM16TCTTACTTCTCCGAGATCCGAAAGATCTCAGGCCGTTTGTCCAT
C/EBPβAGCGGCTGCAGAAGAAGGTGGCAGCTGCTTGAACAAGTTC
UCP1GCCATCTGCATGGGATCAAGGTCGTCCCTTTCCAAAGTG
PPARγGTGCCAGTTTCG ATCCGT AGAGGCCAGCATCGTGTAGATA
aP2AACACCGAGATTTCCACACATTCCACCACCAG
CideaACAGAAATGGACACCGGGTAGTCGAAGGTGACTCTGGCTATTCC
36B4TCCAGGCTTTGGGCATCATTATCAGCTGCACATCACTCAGAAT