Table 2: Primer sequences of mouse for real-time RT-PCR.

Gene (mouse)Forward (5′-3′)Reverse (3′-5′)

NephrinCCCAGGTACACAGAGCACAACTCACGCTCACAACCTTCAG
PodocinGTGAGGAGGGCACGGAAGAGGGAGGCGAGGACAAGA
GAPDHGTCTTCACTACCATGGAGAAGGTCATGGATGACCTTGGCCAG
PGC-1CGGAAATCATATCCAACCAGTGAGGACCGCTAGCAAGTTTG
mtDNATTTTATCTGCATCTGAGTTTAATCCTGTCCACTTCATCTTACCATTTATTATCGC
18S rRNAGGACCTGGAACTGGCAACATGCCCTGAACTCTTTTGTGAAG