Table 2: The sequence of primers used in experiments.

GenePrimer sequence (5′-3′)Annealing temperature (°C)

GADPH
 FGGACCTCATGGCCTACATGG57.6
 RTAGGGCCTCTCTTGCTCAGT
IL-6
 FGGCGGATCGGATGTTGTGAT57.3
 RGGACCCCAGACAATCGGTTG
IL-1β
 FCTTTGAAGTTGACGGACCC53.1
 RTGAGTGATACTGCCTGCCTG
TNF-α
 FCACCACCATCAAGGACTCAA54.5
 RAGGCAACCTGACCACTCTCC
PPAR-γ
 FCCCAATGGTTGCTGATTACA54.4
 RGGACGCAGGCTCTACTTTGA
NFκBp65
 FTGCGATTCCGCTATAAATGCG60.2
 RACAAGTTCATGTGGATGAGGC
Bax
 FAGACAGGGGCCTTTTTGCTAC57.3
 RAATTCGCCGGAGACACTCG
Bcl-2
 FGAGCCTGTGAGAGACGTGG57.3
 RCGAGTCTGTGTATAGCAATCCCA