PPAR Research / 2019 / Article / Tab 1

Research Article

Arsenic Trioxide in Synergy with Vitamin D Rescues the Defective VDR-PPAR- Functional Module of Autophagy in Rheumatoid Arthritis

Table 1

Sequences of primers.

Target geneForward primer (5′–3′)Reverse primer (5′–3′)

GAPDHGCACCGTCAAGGCTGAGAACTGGTGAAGACGCCAGTGGA
PPAR- γTGGAATTAGATGACAGCGACTTGGCTGGAGCAGCTTGGCAAACA
VDRACTCACCTCTGCCTCAATGTGAAGATGAGGCAACAGCATTATCCAAG
LC3CTTCTGAGCCAGCAGTAGGGGGCAGAGTAGGTGGGTTGGT
P62ACATAGCTTGCCTAATGGCTTTCACCCTGCCTGCTGACAACACCTA
mTORGGCCTGGATGGCAACTACAGATGACTGGCCAGCAGAGTAGGAA

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.