Research Article

Fenofibrate Protects Cardiomyocytes from Hypoxia/Reperfusion- and High Glucose-Induced Detrimental Effects

Figure 2

Evaluation of the efficiency of the coverslip assay by quantification of HIF-1α in primary cultures of cardiomyocytes undergoing hypoxia/reperfusion (H/R). (a) Quantification of mRNA HIF-1α performed through qPCR. HIF-1α sense: ATACCAGCAGTAACCAGCCG; antisense: CTGTGGCTGAGAGTCCTTCG. (b) Protein expression of HIF-1α by Western blot and quantified by densitometric analysis. The values represent the (SEM) of 5 different experiments. % vs. control. Student’s unpaired-test.
(a)
(b)