Research Article
Genetic Diversity of Melipona mandacaia SMITH 1863 (Hymenoptera, Apidae), an Endemic Bee Species from Brazilian Caatinga, Using ISSR
Table 2
Selected ISSR primers with their respective sequences, number of bands, and percentage of polymorphism.
| Primers | Sequence (5′ → 3′) | Total number of bands | Number of polymorphic bands | % |
| UBC 807 | AGAGAGAGAGAGAGAGT | 10 | 10 | 100 | UBC 808 | AGAGAGAGAGAGAGAGC | 10 | 5 | 50.0 | UBC 811 | GAGAGAGAGAGAGAGAC | 10 | 6 | 60.0 | UBC 813 | CTCTCTCTCTCTCTCTT | 9 | 6 | 66.6 | UBC 815 | CTCTCTCTCTCTCTCTG | 13 | 10 | 77.0 | UBC 835 | AGAGAGAGAGAGAGAGYC | 14 | 11 | 78.6 | UBC 841 | GAGAGAGAGAGAGAGACTC | 8 | 6 | 75.0 | UBC 855 | ACACACACACACACACCTT | 10 | 9 | 90.0 | UBC 857 | ACACACACACACACACYG | 11 | 7 | 63.6 | UBC 889 | AGTCGTAGTACACACACACACAC | 14 | 8 | 57.1 |
|
|