Table 1: List of primer sequences used in this study.

GenePrimer sequence (5′ to 3′)Annealing Temp.Size
(bp)
Reference

AFP GCTTGGTGGTGGATGAAACA
TCCTCTGTTATTTGTGGCTTTTG
62157[22]
ALB TGAGAAAACGCCAGTAAGTGAC
TGCGAAATCATCCATAACAGC
62265[22]
CYP3A4 CCTTACAT TACACACCCTTTGGAAGT
AGCTCAATGCATGTACAGAATCCCCGGTTA
62382[22]
HNF4αGCCTACCTCAAAGCCATCAT
GACCCTCCCAGCAGCATCTC
62275[22]
AAT ACATTTACCCAAACTGTCCATT
GCTTCAGTCCCTTTCTCGTC
56183[23]
TTR GGTGAATCCAAGTGTCCTCTGAT
GTGACGACAGCCGTGGTGGAA
61352[24]
G6P GCTGGAGTCCTGTCAGGCATTGC
TAGAGCTGAGGCGGAATGGGAG
56350[23]
TAT CCCCTGTGGGTCAGTGTT
GTGCGACATAGGATGCTTTT
56345[23]
GAPDH AGCCACATCGCTCAGACACC
GTACTCAGCGGCCAGCATCG
60302[25]

ALB: albumin; AFP: alpha-fetoprotein; AAT: alpha-1-antitrypsin; CYP3A4: cytochrome P450 type 3A4; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; G6P: glucose-6-phosphatase; HNF4α: hepatocyte nuclear factor 4α; TAT: tyrosine aminotransferase; TTR: transthyretin; Temp.: temperature; bp: base pair.