Stem Cells International / 2014 / Article / Tab 1

Research Article

Reducing TRPC1 Expression through Liposome-Mediated siRNA Delivery Markedly Attenuates Hypoxia-Induced Pulmonary Arterial Hypertension in a Murine Model

Table 1

Primers used for real-time PCR amplification.

GeneGenBank accession numberForward primer (5′-3′)
Reverse primer (5′-3′)
PCR product size (bp)

eNOSNM_021838-2TGGAAATTAACGTGGCTGTG
GCCTTCTGCTCATTTTCCAA
112

ET-1M64711.1TGTCTACTTCTGCCACCTGGA
CCTAGTCCATACGGGACGAC
69

TNF-αBC107671.1GTCTACTGAACTTCGGGGTGA
ATGAGAGGGAGCCCATTTG
67

MMP-9NM_031055.1AAAAGGCATCCAGCATCTGT
AGCTGTCGGCTGTGGTTC
88

α-MHCNM_017239.2CGAAACTGAAAACGGCAAG
TGGCCATGTCCTCGATCT
92

β-MHCNM_017240.1GCTGCAGAAGAAGCTCAAAGA
GCAGCTTCTCCACCTTGG
98

BaxNM_017059.1GTGAGCGGCTGCTTGTCT
GACTCCAGCCACAAAGATGG
107

Caspase 3NM_012922.2AAACCTCCGTGGATTCAAAA
AGCCCATTTCAGGGTAATCC
123

Bcl-2NM_016993.1GGGATGCCTTTGTGGAACT
CTGAGCAGCGTCTTCAGAGA
82

α-actinU19893-1CTGGGGCCTGAGGAGTTC
CCGGTTGAACTCAGCATCA
87

eNOS = endothelial nitric oxide synthase; ET-1 = endothelin-1; TNF-α = tumor necrotic factor alpha; MMP = matrix metalloproteinase; MHC = myosin heavy chain; PCR = polymerase chain reaction.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.