Table 1: Sequence of primers used for candidate of reference genes and the evaluation of lineage specific genes.

Gene name (symbol)Primer sequencesAmplicon size (bp)Accession number or reference

18S ribosomal RNA (18S)F: cgcggaaggatttaaagtg  
R: aaacggctaccacatccaag
141AY265350.1

H2A histone family, member Z (H2A)F: ggtaaggctgggaaggactc 
R: catggctggtcgtcctagat
124NM_001123122.1

Hypoxanthine phosphoribosyltransferase1 (HPRT1)F: aagcttgctggtgaaaagga 
R: gtcaagggcatagcctacca
100NM_001032376.2

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)F: acactcactcttctacctttg 
R: caaattcattgtcgtaccag
90Nygard et al., 2007 [14]

TATA box binding protein (TBP)F: aacagttcagtagttatgagccaga 
R: agatgttctcaaacgcttcg
153Nygard et al., 2007 [14]

Ribosomal protein 4 (RPL4)F: caagagtaactacaaccttc 
R: gaactctacgatgaatcttc
122Nygard et al., 2007 [14]

Peptidylprolyl isomerase A (PPIA)F: aaaacttccgtgctctgagc 
R: ttatggcgtgtgaagtcacc
112NM_214353.1

Beta-2-microglobulin (B2M)F: tccgccccagattgaaattg 
R: tccttgctgaaagacaggtctg
81NM_213978.1

Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ)F: tgcttcctttgcttgcatcc 
R: tcagggtaggcagggtttatag
113XM_001927228.4

Beta actin (ACTB)F: tcaacaccccagccatgtac 
R: agtccatcacgatgccagtg
84XM_003124280.2

Succinate dehydrogenase complex, subunit A (SDHA)F: cacacgctttcctatgtcgatg 
R: tggcacagtcagcttcattc
94XM_003362140.1

Hydroxymethylbilane synthase (HMBS)F: ttcattccctcaaggacctg 
R: ggggtgaaagacaacagcat
101NM_001097412.1

Adipocyte fatty acid binding protein (AP2)F: aacccaacctgatcatcactg 
R: tctttccatcccacttctgc
192AF102872.1

Lipoprotein lipase (LPL)F: caaacttgtggctgccctat 
R: aaggctgtatcccaggaggt
202Kumar et al., 2007 [24]

Osteonectin (ON)F: tccggatctttcctttgctttcta 
R: ccttcacatcgtggcaagagtttg
187Kumar et al., 2007 [24]

Osteopontin (OPN)F: actccgatgaatccgatgag 
R: tccgtctcctcactttccac
220Kumar et al., 2007 [24]

Aggrecan (ACAN)F: agtggattggcttgaacgac 
R: agtggcgaagaagttgtcag
113NM_001164652.1

Collagen, type X, alpha 1 (COL10A1)F: gcaaacatgctgccacaaac 
R: gatgaagaactgtgccttggtg
141NM_001005153.1