Research Article
Human Bone Marrow Stromal Cells: A Reliable, Challenging Tool for In Vitro Osteogenesis and Bone Tissue Engineering Approaches
Table 1
Primer pairs used for real time PCR.
| Gene | Accession number | Forward primer | Reverse primer | Binding position | Product length (bp) | Product identity (%)## |
| actin | NM001101 | aatgtggccgaggactttgattgc | ttaggatggcaagggacttcctgt | 1414–1508 | 95 | 100 | oct-4 | NM203289 | cttcaggagatatgcaaa | ccggttacagaacca | 1367–1561 | 195 | 93 | cbfa1 | NM00102463 | aatgacaccaccaggccaat | tggcctacaaaggtgggttt | 3646–3805 | 160 | 100 | pthr | NM000316 | ttggcgtccactacattgtc | tccctggaaggagttgaaga | 1453–1559 | 107 | 98 | bglap | NM199173 |
ggtggagcctttgtgtccaagc | gtcagccaactcgtcacagtcc | 169–327 | 159 | 97 | ppar | NM138711 | tccgtggatctctccgtaat | ctgcaaccactggatctgtt | 302–437 | 136 | 96 |
|
|
Genes: actin, -actin; oct-4, octamer binding transcription factor 4; cbfa, core-binding factor subunit alpha-1; pthr, parathyroid hormone receptor; bglap, bone gla protein = osteocalcin; ppar, peroxisome proliferator-activated receptor gamma. Determined by sequencing of amplified DNA products.
|