Stem Cells International / 2016 / Article / Tab 1

Research Article

Bone Formation from Porcine Dental Germ Stem Cells on Surface Modified Polybutylene Succinate Scaffolds

Table 1

Sequences of the primers used for the real-time PCR.

ALPF: CGACAACTACCAGGCACAGTTm: 57°CProduct length: 248
R: GCCCTCAGAACAAGATGCCT

Runx2F: ACTGAACCCCACGCTTGTTCTm: 59°CProduct length: 253
R: AGTCACCTCCGCTTTCAAGG

OsteopontinF: AGTCCAACGAAAGCCCTGAGTm: 57°CProduct length: 292
R: GCTTCGGATCTGCGGAACTT

OsteocalcinF: CCTAGTGGTGCGGATTCTGGTm: 55°CProduct length: 241
R: GCTGCGAGGTCTAGGCTATG

Collagen type I F: GACATCCCACCAGTCACCTGTm: 58°CProduct length: 229
R: CTCCCGTGGTTTCCTGGTC

Beta-actinF: GACTTCGAGCAGGAGATGGTm: 56°CProduct length: 233
R: GCACCGTGTTGGCGTAGAG

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.