Table 1: Oligonucleotide primer sequences for quantitative real-time PCR analysis of gene expression.

Target geneSequences (5′-3′)Product size (bp)GenBank accession number

GAPDHForward, TGCCACTCAGAAGACTGTGG129AF106860
Reverse, TTCAGCTCTGGGATGACCTT
RUNX2Forward, CCACCACTCACTACCACACG119NM_001278483
Reverse, GGACGCTGACGAAGTACCAT
OPNForward, GATCGATAGTGCCGAGAAGC111M99252
Reverse, TGAAACTCGTGGCTCTGATG
OSXForward, CCAATGACTACCCACCCTTTC109AY177399
Reverse, ACACTAGGCAGGCAGTCAGAA
PPARγ2Forward, GGTTGACACAGAGATGCCATT123NM_001145367
Reverse, CTGGAGAAATCAACCGTGGTA