Neuropilin 1 Mediates Keratinocyte Growth Factor Signaling in Adipose-Derived Stem Cells: Potential Involvement in Adipogenesis

Table 1

List of primers used for the expression analysis of NRP1 by RT-PCR and custom primers/probes used for the expression analysis of FGFR2-IIIb and FGFR2-IIIc by qRT-PCR.

Gene	Forward primer sequence	Reverse primer sequence	Reporter sequence
NRP1	cctgaatgttcccagaactacacaa	caacatcagggaatccatccc	—
FGFR2-IIIb	ggctctgttcaatgtgaccga	gttggcctgccctatataattgga	ttccccagcatccgcc
FGFR2-IIIc	cacggacaaagagattgaggttct	ccgccaagcacgtatattcc	ccagcgtcctcaaaag