Stem Cells International / 2018 / Article / Tab 1

Research Article

Human Urine-Derived Stem Cells: Potential for Cell-Based Therapy of Cartilage Defects

Table 1

Primer sequences (5-3) used for RT-PCR.

GenePrimer sequences (5 → 3)Amplification size (bp)

hCOL2A1FGCTCCCAGAACATCACCTACC192 bp
hCOL2A1RCAGTCTTGCCCCACTTACCG
hSox9FCTCCTACCCGCCCATCAC114 bp
hSox9RTAGGTGAAGGTGGAGTAGAGGC
hACANFGCCTATCAGGACAAGGTCTCAC185 bp
hACANRATGGCTCTGTAATGGAACACGA
h-Actin rCTGGAAGGTGGACAGCGAGG205 bp
h-Actin fTGACGTGGACATCCGCAAAG

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.