Stem Cells International / 2020 / Article / Tab 3

Research Article

circRNA Expression Profile in Dental Pulp Stem Cells during Odontogenic Differentiation

Table 3

The primer list was used for real-time quantitative PCR.

GeneForward primerReverse primer

GAPDH5 CTGGGCTACACTGAGCACC35 AAGTGGTCGTTGAGGGCAATG3
DSPP5TTTGGGCAGTAGCATGGGC35CCATCTTGGGTATTCTCTTGCCT3
DMP15CTCCGAGTTGGACGATGAGG35TCATGCCTGCACTGTTCATTC3
OCN5ACCTCACCTTCCTCTACTTGG35TGGTGTCATTAGCCTTGCAG3
hsa_circRNA_1041015GGAGCAACAGTAGAAAGTTCTCTA35GGCACCTTCATCAGTAGTCATT3
hsa_circRNA_4067635 GTCTTTAGTCTTGGCAAAGGTGT35CAATGCATCAGAAAGGGAACA3
hsa_circRNA_0021615TCCGGAGAACCAAACGGAAA35GAACTGTCCAAAGGCGGAAAA3
hsa_circRNA_0050445CAAAGCAACGAGCTCTATGCC35CAAAGCAACGAGCTCTATGCC3
hsa_circRNA_0798135TGGAACCTACAAGCAGCACC35TGCCATCAGGATTTCGATCTGT3
hsa_circRNA_0083365TGGAACCTACAAGCAGGCAT35CTGGCAAAACCTGGGAAGAGA3

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.