Stem Cells International / 2021 / Article / Tab 1

Research Article

Rho/ROCK Inhibition Promotes TGF-β3-Induced Tenogenic Differentiation in Mesenchymal Stromal Cells

Table 1

Human primers for real-time PCR.

GenePrimer sequenceAccessionPCR product (bp)

GAPDHFor: CCACTCCTCCACCTTTGACG
Rev: CCCTGTTGCTGTAGCCAAATTC
NM_001256799.1101
Collagen 1A2For: CAAGGACAAGAAACACGTCTGG
Rev: GTTGGGTAGCCATTTCCTTGG
NM_000089.3101
Collagen 3A1For: TGAATATCGAACACGCAAGGC
Rev: AAAGCAAACAGGGCCAACG
NM_000090.3109
ScleraxisFor: GCGACGGCGAGAACACC
Rev: TCCTTGCTCAACTTTCTCTGGTT
NM_001080514.173
Tenascin-CFor: CTCTGGAAGACACCGTTGGC
Rev: GAAGTGGTGTTTCTTGGAAGCTG
NM_002160.3101
Smad 3For: GGTCTGCGTGAATCCCTACC
Rev: TTATGTGCTGGGGACATCGG
NM_005902.3294
Smad 8For: CCTGTAGATGCCACAGCTGATA
Rev: GGGAGGAAGCCTGGAATGTC
NM_001127217.2151
TGF-β3For: AGCGCTATATCGGTGGCAAG
Rev: TCATCCTCATTGTCCACGCC
NM_003239.4226

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.