Stem Cells International / 2021 / Article / Tab 2

Research Article

Rho/ROCK Inhibition Promotes TGF-β3-Induced Tenogenic Differentiation in Mesenchymal Stromal Cells

Table 2

Equine primers for real-time PCR.

GenePrimer sequenceAccessionPCR product (bp)

GAPDHFor: TGGAGAAAGCTGCCAAATACG
Rev: GGCCTTTCTCCTTCTCTTGC
NM_001163856.1309
Collagen 1A2For: CAACCGGAGATAGAGGACCA
Rev: CAGGTCCTTGGAAACCTTGA
XM_001492939.1243
Collagen 3A1For: AGGGGACCTGGTTACTGCTT
Rev: TCTCTGGGTTGGGACAGTCT
XM_001917620.2216
ScleraxisFor: TACCTGGGTTTTCTTCTGGTCACT
Rev: TATCAAAGACACAAGATGCCAGC
NM_001105150.151
Tenascin-CFor: TGAATATGGAATTGGAGTGTCTGC
Rev: GGAGTTCTCCACACCAGAGTC
XM_023628743.1147
Smad 3For: GCTGTGTGAGTTCGCCTTCA
Rev: CGGGGATGGAATGGCTGTAG
XM_023654980.1164
Smad 8For: AGCCTCCGTGCTCTGCATT
Rev: CCCAACTCGGTTGTTTAGTTCAT
AB106117.1200
TGF-β 3For: TGCCCCAAAGGAATCACCTC
Rev: GCGTTGTTTGGCGATATGCT
XM_001492687.689

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.