Co-Cultures of Pseudomonas aeruginosa and Roseobacter denitrificans Reveal Shifts in Gene Expression Levels Compared to Solo Cultures

Table 1

Primer sequences used in Quantitative PCR analyses of gene expression of target bacteria in solo and co-cultures.

Target gene	Abbreviation	Source species	Primer sequences, 5′ to 3′	Gene product length
DNA directed RNA polymerase, subunit alpha	HGK	P. aeruginosa	TGATTTCGGTCAGGGACTTC; GATGACCTGGAACTGACCGT	139
DNA directed RNA polymerase, subunit alpha	HGK	R. denitrificans	TCACCTCTGTGCAGATCGAC; TGTCACCAGCAGTCACAACA	177
Thiosulfate:cyanide sulfurtransferase (Rhodanese)	RdhA	P. aeruginosa	AGGAAGTGATCACCCACTGC; CTCTACAGGGGTATCGGGGT	140
Biosynthesis of pyocyanin	PhzH	P. aeruginosa	TGCGCGAGTTCAGCCACCTG; TCCGGGACATAGTCGGCGCA	214
Metallo-beta-lactamase	BetaLact	R. denitrificans	AATACGAATTGCCCAGCATC; GCAGGCCATAACAACAACCT	184
Dimethylpropiothetin dethiomethylase	DMSP	R. denitrificans	GTGCCGCACTGGCTGTGGAT	125