The Scientific World Journal / 2012 / Article / Tab 2

Research Article

Evidence for Directed Evolution of Larger Size Motif in Arabidopsis thaliana Genome

Table 2

Frequency of occurrence of nitrogenous bases when spacer sequence length between two ACGT palindromes is gradually increased from 5 to 25 nucleotides.

ACGTSeq. usedGapCount

(ACGT)N5(ACGT)ACGTGGCT_ACGT72423334725690
(ACGT)N6(ACGT)ACGTGGCTA_ACGT98654544446611
(ACGT)N7(ACGT)ACGTGGCTAT_ACGT92917780777824
(ACGT)N8(ACGT)ACGTGGCTATG_ACGT97306455648852
(ACGT)N9(ACGT)ACGTGGCTATGG_ACGT39322232329602
(ACGT)N10 (ACGT)ACGTGGCTATGGC_ACGT343639663910600
(ACGT)N11(ACGT)ACGTGGCTATGGCG_ACGT362338293811681
(ACGT)N12(ACGT)ACGTGGCTATGGCGG_ACGT565465455612638
(ACGT)N13(ACGT)ACGTGGCTATGGCGGA_ACGT785077597713652
(ACGT)N14(ACGT)ACGTGGCTATGGCGGAG_ACGT865396525314841
(ACGT)N15(ACGT)ACGTGGCTATGGCGGAGC_ACGT566744665615709
(ACGT)N16(ACGT)ACGTGGCTATGGCGGAGCA_ACGT603452346016843
(ACGT)N17(ACGT)ACGTGGCTATGGCGGAGCAA_ACGT394142394217830
(ACGT)N18(ACGT)ACGTGGCTATGGCGGAGCAAG_ACGT494758484918719
(ACGT)N19(ACGT)ACGTGGCTATGGCGGAGCAAGA_ACGT503849444419695
(ACGT)N20(ACGT)ACGTGGCTATGGCGGAGCAAGAT_ACGT343044373720821
(ACGT)N21(ACGT)ACGTGGCTATGGCGGAGCAAGATT_ACGT364042434021717
(ACGT)N22(ACGT)ACGTGGCTATGGCGGAGCAAGATTC_ACGT534242465322726
(ACGT)N23(ACGT)ACGTGGCTATGGCGGAGCAAGATTCA_ACGT915560615523771
(ACGT)N24(ACGT)ACGTGGCTATGGCGGAGCAAGATTCAC_ACGT7764575353241171
(ACGT)N25(ACGT)ACGTGGCTATGGCGGAGCAAGATTCACT_ACGT766258696225708

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.