The Scientific World Journal / 2013 / Article / Tab 1

Research Article

Association of Self-DNA Mediated TLR9-Related Gene, DNA Methyltransferase, and Cytokeratin Protein Expression Alterations in HT29-Cells to DNA Fragment Length and Methylation Status

Table 1

List of the oligonucleotide primers used.

Toll-like receptor 9-related signaling (MYD88-dependent pathway)

Toll-like receptor 9 F: CAATGTCACCAGCCTTTCCT
R: CAGGTGGGCAAAGTCAGAAT

MYD88AF: GAAGAAAGAGTTCCCCAGCA
R: GTGCAGGGGTTGGTGTAGTC

MYD88BF: CTCCTCCACATCCTCCCTTC
R: CGCACGTTCAAGAACAGAGA

IRAK2F: CTTGGAGTGGGCTTTCTGAG
R: AGGCTGGAATTGTCAACGTC

TRAF6F: CTTTGGCAAATGTCATCTGTG
R: CTGAATGTGCATGGAATTGG

NF BF: TATGTGGGACCAGCAAAGGT
R: GCAGATCCCATCCTCACAGT

TNFSF10F: ATCTGGGACGGTGCTGTAAC
R: CAGGGCAGACATACACTGTCA

Toll-like receptor 9-related signaling (MYD88-independent pathway)

IRF7B F: GGGTGTGTCTTCCCTGGATA
R: GCTCCATAAGGAAGCACTCG

Epithelial cell-derived proinflammatory chemokine (neutrophil chemotactic factor)

IL8F: GTGCAGTTTTGCCAAGGAGT
R: AAATTTGGGGTGGAAAGGTT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.