The Scientific World Journal / 2013 / Article / Tab 2

Research Article

Mutations in MC1R Gene Determine Black Coat Color Phenotype in Chinese Sheep

Table 2

Genotype and allele frequencies of the 5 SNPs in MC1R in Chinese sheep breeds.

BreedMC1R1 c.218 T>AMC1R1 c.361 G>AMC1R1 c.429 C>TMC1R1 c.600 T>GMC1R1 c.735 C>T
GenotypeAllele frequencyGenotypeAllele frequencyGenotypeAllele frequencyGenotypeAllele frequencyGenotypeAllele frequency
AAATTTATAAAGGGAGTTCTCCTCGGGTTTGTTTTCCCTC

Minxian Black-fur172900.66300.3370172900.66300.3370361000.89130.1087361000.89130.1087361000.89130.1087
Tibetan01410.01190.988101410.01190.9881172050.64290.3571172050.64290.3571172050.64290.3571
Large-tailed Han004801004801214320.18750.8125214320.18750.8125214320.18750.8125
Small-tailed Han003401003401101680.52940.4706101680.52940.4706101680.52940.4706
Mongolian18420.09800.902018420.09800.9020928140.45100.5490928140.45100.5490928140.45100.5490
Tan02430.02220.977802430.02220.9778820170.40000.6000820170.40000.6000820170.40000.6000
Kazakh Fat-Rumped2880.33330.66672880.33330.666761200.66670.333361200.66670.333361200.66670.3333
Gansu Alpine Merino003401003401617110.42650.5735617110.42650.5735617110.42650.5735
China Merino002701002701116100.33330.6667116100.33330.6667116100.33330.6667
Duolang01270.01790.982101270.01790.982161480.46430.535761480.46430.535761480.46430.5357

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.