Table 1: Sequences of the primers used in this study.

GeneDirectionPrimer sequence (5′-3′)Product size (bp)

TNF-αFCTCTTCTCATTCCCGCTCGT 104
RGGGAGCCCATTTGGGAACTT

IL-6FCCAGTTGCCTTCTTGGGACT 224
RTCTGACAGTGCATCATCGCT

GAPDHFTGCCACTCAGAAGACTGTGG 129
RTTCAGCTCTGGGATGACCTT