The Scientific World Journal / 2014 / Article / Tab 1

Research Article

Expression Profiles of 12 Late Embryogenesis Abundant Protein Genes from Tamarix hispida in Response to Abiotic Stress

Table 1

Primers used for quantitative real-time RT-PCR analysis.

GeneGenBank accession numberForward primer (5′-3′)Reverse primer (5′-3′)

ThLEA-1 KF801660CAGCGAAGTTTGGATGGAATG ACCTGTCGCCAATCAGAAGAT
ThLEA-2 KF801661CACACAATAGAAACCGTAGAGCCTCCATGGTCTCCTTAACT
ThLEA-3 KF801662CGAGATCCTTGGTGGAGCTCGTCACGTATGTGTCATGACTAC
ThLEA-4 KF801663GTGGCTATCTCGATTCGTAGTGCAACAGACACCAACCAAGAT
ThLEA-5 KF801664GTTCGCAGCAGGAAAGAGCAGACTCCGTCAACACGGTACTACT
ThLEA-6 KF801665GTTGAGGATGTGGATATCAAGCGAGTTCATAATCGATATCC
ThLEA-7 KF801666TCATGATATTGGTGAGAAGAGTGGTATCTTAACAGTCTCT
ThLEA-8 KF801667GATGACGACACATGATGAAGCAGCCTCCACAGTCCCTTCCGT
ThLEA-9 KF924555GTGGTTGTGGAGATGAACGGAGGGTAGCAGCATCATCAGCAATG
ThLEA-10 KF924556AGAGTCAGCAACCGATACAGCTCTCTGCCTTGCTGATTCCTC
ThLEA-11 KF924557ACGGAGGAAGCTAGGCACGAAGCTGCTGCGTCCTTGTATTCC
ThLEA-12 KF924558CAAGATGCAGGAGGTGGTGATATCTGCTATTCTTCTGCCTGT
Actin FJ618517AAACAATGGCTGATGCTGACAATACCGTGCTCAATAGG
-Tubulin FJ618518CACCCACCGTTGTTCCAGACCGTCGTCATCTTCACC
-Tubulin FJ618519GGAAGCCATAGAAAGACCCAACAAATGTGGGATGCT