The Scientific World Journal / 2014 / Article / Tab 1

Research Article

Two-Component Signal Transduction System SaeRS Positively Regulates Staphylococcus epidermidis Glucose Metabolism

Table 1

Oligonucleotide primers used for RT real-time PCR.

Target geneGene descriptionGenBank accession no.Primer*Primer sequenceLocationFunction

gyrB DNA gyrase, B subunit57636585gyrBF 
gyrBR
CTTATATGAGAATCCATCTGTAGG
AGAACAATCTGCCAATTTACC
1110–1263House keeping gene

pta Phosphate acetyltransferase57866177ptaF
ptaR
AGGTTCTGCTAAATCGGATGATG
GGTGCTTTCTTCTCTGCTACG
767–922Catalyzes the conversion of acetyl-CoA and phosphate to CoA and acetyl phosphate

gapA-1 Glyceraldehyde 3-phosphate dehydrogenase57866427gapA-1F
gapA-1R
ACACAAGACGCACCTCAC
TCTGGAATAACTTTACCGATAGC
709–821Catalyzes the formation of 1,3-bisphosphoglycerate from glyceraldehyde-3-P in glycolysis

eno Enolase; phosphopyruvate hydratase 57866440enoF
enoR
GCCAATTATTACAGATGTTTACG
CAGTAGAAGCACCAGAAGG
200–327Catalyzes the formation of phosphoenolpyruvate from 2-phospho-D-glycerate in glycolysis

sucD Succinyl-CoA synthetase alpha subunit 57866714sucDF
sucDR
AGAAGAAGAAGCGGCACAATG
GCAGTTTCAACACCACAATCG
779–958Catalyzes the only substrate-level phosphorylation in the TCA cycle

icd Isocitrate dehydrogenase57867183icdF
icdR
ACTATATCTCTGATGCTCTTG
TTCTGATGACGGATTAACC
1118–1272Converts isocitrate to alpha ketoglutarate

pyk Pyruvate kinase57867187pykF
pykR
CGAGTTTCAGTGTTAGGTC
CGTAGAGGTTAATTGATTATTCC
4–159Catalyzes the formation of pyruvate from phosphoenolpyruvate in glycolysis

fbaA Fructose-bisphosphate aldolase57867608fbaAF
fbaAR
TGCTGATGGCGTTATCTATG
CCGTGTAATACTAAAGGTAATCC
575–757Catalyzes the formation of glycerone phosphate and glyceraldehyde 3-phosphate from fructose 1,6-bisphosphate

F: forward primer; R: reverse prime.