The Scientific World Journal / 2016 / Article / Tab 1

Research Article

Identification of Genes Coding Aminoglycoside Modifying Enzymes in E. coli of UTI Patients in India

Table 1

Primer specification.

NameSubfamilyPrimer sequence (53)PCR product

rrsrrs1GGATTAGATACCCTGGTAGTCC320
rrs2TCGTTGCGGGACTTAACCCAAC

aacCaacC1-1ACCTACTCCCAACATCAGCC169
aacC1-2ATATAGATCTCACTACGCGC
aacC2-1ACTGTGATGGGATACGCGTC237
aacC2-2CTCCGTCAGCGTTTCAGCTA
aacC3-1CACAAGAACGTGGTCCGCTA185
aacC3-2AACAGGTAAGCATCCGCATC
aacC4-1CTTCAGGATGGCAAGTTGGT286
aacC4-2TCATCTCGTTCTCCGCTCAT
aadC-1GCAAGGACCGACAACATTTC165
aadC-2TGGCACAGATGGTCATAACC

aacA-aphDaacA-aphD-1 CCAAGAGCAATAAGGGCATA220
aacA-aphD-2CACTATCATAACCACTACCC

aphA3aphA3-1GCCGATGTGGATTGCGAAAA292
aphA3-2GCTTGATCCCCAGTAAGTC

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.