Research Article
A Nodulation-Proficient Nonrhizobial Inhabitant of Pueraria phaseoloides
Table 1
Primers used for the amplification of nifD and nifH genes in this study.
| Gene | Primer sequence (5’-3’) | Product size | Reference |
| nifD | nifD_F: CGGTTACTGGTCTTGGTCTGGTC nifD_R: GCGTCGTTAGCGATGTGGTGTC | 338 bp | Glass et al. (2010) [6]
| nifH | PolFor: TGCGACCCGAAGGCTGAC PolR: ATGGCCATCATCTCACCGGA | 360 bp | Poly et al. (2001) [7] |
|
|