Isolation and Molecular Identification and Antimicrobial Susceptibility of <i>Providencia</i> spp. from Raw Cow’s Milk in Baghdad, Iraq

Ayyal Al‐Gburi, Nagham Mohammed

doi:https://doi.org/10.1155/2020/8874747

Veterinary Medicine International

On this page

Abstract Introduction Materials and Methods Results Discussion Conclusions Data Availability Conflicts of Interest Acknowledgments References Copyright Related Articles

Research Article Corrigendum

!

A Corrigendum for this article has been published. To view the article details, please click the ‘Corrigendum’ tab above.

Research Article | Open Access

Volume 2020 | Article ID 8874747 | https://doi.org/10.1155/2020/8874747

Isolation and Molecular Identification and Antimicrobial Susceptibility of Providencia spp. from Raw Cow’s Milk in Baghdad, Iraq

Nagham Mohammed Ayyal Al‐Gburi¹

Academic Editor: Nora Mestorino

Received20 May 2020

Revised24 Sept 2020

Accepted28 Oct 2020

Published19 Nov 2020

Abstract

A total of sixty raw milk samples were collected from (street vendors and shops) from Baghdad city, Iraq. The samples were inoculated into peptone water and, then, subcultured onto MacConkey agar and Blood agar. Identification of isolates was confirmed by microscopic examination, cultural characteristic, biochemical tests, Vitek (VITEK®2 system), and Biolog GN substrate reactions followed by 16S rRNA and specific genes sequencing. Of 60 raw cow’s milk samples, Providencia spp. were identified only in 4 samples (6.67%) and P. rettgeri was the most common, 2/4 (50%), followed by P. stuartii and P. vermicola, 1/4 (25%). Antimicrobial susceptibility tests were conducted against ten antibiotics by the disc diffusion method. All Providencia isolates showed multidrug resistance (MDR), and the absolute resistant was 100% to tetracycline, erythromycin, and doxycycline and 50% against ampicillin\sulbactam and amoxicillin/clavulanic acid. They were highly susceptible (100%) to trimethoprim, imipenem, and chloramphenicol. These findings indicate that milk might be contaminated with Providencia spp. leading to transmission to humans causing poisoning, diarrhea, and other infections. This is the first study of isolated Providencia spp. from raw cow’s milk.

1. Introduction

Before 2005, the genus Providencia was including six species; after that, a new species was identified to become nine species which are P. alcalifaciens, P. rustigianii, P. stuartii, P. rettgeri, P. friedericiana, P. heimbachae, P. vermicola, P. sneebia, and P. thailandensis [1–3]. The Providencia spp. are urease-producing Gram-negative, belonging to the family Enterobacteriaceae. Although these species are present as normal flora in the human intestinal tract, they are opportunistic pathogens, especially in immunocompromised people causing traveler’s diarrhea, gastroenteritis and infection of the urinary tract and endocardium, sepsis in neonatal, and ocular inflammations [4–9]. Animals such as cattle, sheep, insects, worms, cats, birds, dogs, guinea pigs, and reptiles are reservoirs to Providencia spp., as well as this bacterium present in environment such as water (river, cows, and waste) [10–14]. These may explain the isolation of them from different food and food products [9, 15–17].

The laboratory identification of Providencia spp. is depending on culturing and biochemical characteristics. Providencia spp. grow in enteric agars such as MacConkey, Salmonella-Shigella (SS), Eosin Methylene Blue (EMB), and Hektoen Enteric (HE), and selective agars are Simmons Citrate, Tergitol, and HardyCHROM™ UTI [18, 19]. The commercial identification kits currently available include the Analytical Profile Index (API20) Esystem, Vitek GNI and GNI1 cards, and Microscan Rapid Neg ID3panel [20–23] in addition to the molecular identification using 16S rRNA and specific species genes [10, 24, 25].

Providencia spp. reported resistant to antimicrobials and multidrug resistance (MDR), and both P. stuartii and P. rettgeri reported resistant against many antimicrobial drugs. Providencia isolates were investigated to be MDR (75%) [26, 27]. P. rettgeri isolates are found highly resistant against several antimicrobials such as gentamicin, imipenem, polymyxin, tetracycline, nitrofurantoin vancomycin, bacitracin, erythromycin, novobiocin, rifampin, and colistin [28, 29]. P. vermicola has reported 100%resistance to ampicillin, kanamycin, nalidixic acid, and neomycin [25]. Carbapenem-resistant P. stuartii and P. rettgeri were reported; therefore, the treatment has been a problem because MDR is a significant public health challenge [30–32]. Milk has been considered the most nutritious and balanced food being rich in essentials that are important for humans [33].

Milk is considered as a perfect environment for the growth and survival of many microorganisms that are a threat to the public health [34–36]. Contamination of milk with microorganisms occurs via a variety of environmental sources, including soils, water, moisture content, milking apparatus, and surrounding air condition [33, 37, 38]. There are rare investigations of Providencia spp. in raw cow’s milk, especially in Iraq. It has been found that Providencia spp. is one of the bacteria that were isolated from subclinical mastitis [39, 40]. This study was conducted to detect the presence of Providencia spp. in raw cow’s milk and determine the antimicrobial susceptibility to antibiotics.

2. Materials and Methods

2.1. Isolation and Morphological Identification

Sixty raw milk samples were collected from vendors and shops in Baghdad city from March to June 2019. Ten ml of milk samples was taken and inoculated into peptone water, incubated at 37°C for 24 hrs, then subcultured on MacConkey agar and Blood agar (HiMedia, India), and incubated at 37°C for 24 hrs. The suspected Providencia spp. colonies which appear as pale colonies, lactose nonfermenter on MacConkey agar were picked, and conventional biochemical tests were applied including urease, phenylalanine, and triple sugar iron (TSI). They were further identified using the VITEK®2 system and Biolog GN substrate (Biomerieux, France) reactions for more differentiation according to [1, 41].

2.2. Molecular Identification

Molecular identification was applied on three isolates to confirm and differentiate between them. DNA was extracted from isolates growth using the Wizard Genomic DNA Purification Kit protocol (Promega, USA). PCR amplification of bacterial 16S rRNA was applied with 27 forward primer AGAGTTTGATCCTGGCTCAG and 1492 reverse primer TACGGTTACCTTGTTACGACTT 1, 300 bp. The PCR reaction mixture final volume of 25 μl contains PCRpremix 12.5 μl, forward primer 1 μl, reverse primer1 μl, nuclease free water 8.5 μl, and DNA 2 μl. The PCR scheme performed was as follows: 95°C for 5 min/1 cycle; 95°C for 30 sec/30 cycles; and 60°C for 45 sec/30 cycles and extension at 72°C for 1 min/30 cycles and final extension 72°C for 7 min/1 cycle [42]. After amplification, 1% agarose gel electrophoresis was applied to confirm the presence of amplification. Then, the PCR products were purified and sent to be sequenced.

Provi_forward primer CGCATAATCTCTTAGGAGCAAA and Provi_reverse primer ATGAATCACAAAGTGGTAAGCG (size 1306 bp) were used to detect both P. rettgeri/P. vermicola, Provi_foward primer and P_Vermi_reverse primer (AAGGAGR (A/G) TGATCCAGCCGCAG) (size 1366 bp) were used to detect if the isolates are P. vermicola or not. The PCR reaction mixture volume of 20 μl included PCRpremix 10 μl, nuclease free water 6 μl, forward and reverse primer 1 μl to each and DNA 2 μl. The PCR scheme performed was as follows: initial denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 62°C for 30 sec (68°C for 30 sec for Provi_foward primer and P_Vermi_reverse primer), extension at 72°C for 1 min, and final extension 72°C for 7 min [25].

After amplification, 1% agarose gel electrophoresis was applied to confirm the presence of amplification, then PCR products were purified and sent to sequenced, and the results were analyzed using genius software and compared to known sequences in the GenBank and Sepsitest BLAST databases.

2.3. Detected Antimicrobial Susceptibility

Susceptibility against antimicrobial drugs was determined by disk diffusion protocol using Mueller-Hinton (MH) agar (Oxoid, UK). The inhibitory zones around these antimicrobial discs were measured using a millimeter (mm) unit utilizing a metric ruler, and the results were read [43, 44]. Ten antibiotic disks (Merseyside, U.K.) used included amoxicillin 20 µg, clavulanic acid 10 µg (AUG 30C), trimethoprim (TM, 15 µg), ampicillin10 µg\ sulbactam 10 µg (SAM, 20 C), tetracycline (T, 30 µg), erythromycin (E, 10 µg), cefixime (CFM 5 µg), doxycycline (DXT, 30 µg), imipenem (IPM, 10 µg), chloramphenicol (C 30 µg), and streptomycin (S 25 µg). Multidrug resistance (MDR) was detected according to the work of Magiorakos et al. [45]. The isolates resistant against three or more separate antimicrobial classes are considered as MDR. The multiple antibiotics resistance (MAR) index was calculated by dividing (a): the number of antimicrobial drugs resistant of isolate by (b): the total number of antimicrobial drugs, where the same isolate which exposed the results more than 0.2 was considered high risk [46].

3. Results

3.1. Characterization and Molecular Identification of Providencia Species

Providencia species were identified in 4 (6.67%), P. rettgeri were the most dominant species, 2/4 (50%), and P. stuartii and P. vermicola were 1/4 (25%). The isolates were Gram-negative coccobacilli. On MacConkey agar, lactose nonferment colonies are circular with entire edges, shining, smooth, slim, and convex, P. vermicola showed a dense brownish center and hyaline periphery colonies, and the isolate on blood agar are nonheamolysis. Biochemically, it is motile, negative reactions for oxidase, positive for catalase and tryptophan deaminase, on TSI, gives alkaline/acid (pink/yellow) reaction without H₂S and gases production, the isolates were suspected of Providencia spp., and by using the VITEK®2 system, reactions give the positive for three isolates of P. rettgeri and one isolate was P. stuartii.

P. rettgeri isolates (unfortunately, P. stuartii isolate died before completing molecular identification) were sent to be sequenced and analyzed for similarity using a database at the NCBI. The partial gene sequence of 16S rRNA established that these isolates had high similarity between P. rettgeri/P. vermicola in both databases, when using Provi_foward and Provi_reverse (detected both P. rettgeri and P. vermicola), and a band of approximately 1306 bp was observed on the agarose gel (Figure 1). The results of the sequence were as follows: 1^st isolate was 99.91% similar with P. rettgeri, the 2^nd gave 100% similarity to P. rettgeri/P. vermicola, while the 3^rd isolate was 99.81% similar to P. vermicola/P. rettgeri in the Gen bank database and in the Sepsi test BLAST database; similarity were as follows: the 1^st was P. vermicola/P. rettgeri, 99.5%; the 2^nd was P. vermicola/P. rettgeri, 99.9%, while the 3^rd was P. vermicola, 99.8%, and when using Provi_forward and P_Vermi_reverse primer (detected only P. vermicola), the 1^st and 2^nd isolates give no bands, that is, these two isolates were P. rettgeri, while the 3^rd one gives two bands, which were not of the same expected size of 1366 bp; therefore, this isolate was more differentiated from P. rettgeri based on Biolog GN substrate reactions for more biochemical tests, and the sequencing result gives that the 3^rd isolate was P. vermicola, 99.8%; thus, the three isolates were deposited in GenBank with accession nos : MT032351.1, MT032352.1, and MT032359.

3.2. Antimicrobial Susceptibility

As total, all Providencia isolates showed absolute resistance (100%) against tetracycline, erythromycin, and doxycycline, 50% to Amoxicillin\clavulanic acid and ampicillin\sulbactam, and 25% to cefixime. P. vermicola was resistant 100% to amoxicillin 20 μg\clavulanic acid and ampicillin\sulbactam compared with P. rettgeri which was 50% and P. stuartii was 0%. The resistance against streptomycin reported 50% in P. rettgeri. Also, resistance to cefixime was 100% against P. vermicola, while 0% (sensitive) in both P. rettgeri and P. stuartii. All isolates were 0% resistant (100% sensitivity) to trimethoprem, imipenem, and chloramphenicol. The results also revealed that these isolates were MDR. MAR index values were 0.6 in P. rettgeri and P. vermicola and 0.3 in P. stuartii that reveals all isolates were high risk (Table 1).

4. Discussion

Infections with Providencia spp. including P. rettgeri and P. stuartii which cause food poisoning, diarrhea, and UTI have been increased in the world, especially in developed and developing countries [9, 32, 47–51]. P. vermicola was investigated for the first time in infective nematodes, later from a diseased fresh water fish and from an acute watery diarrhea patient [1, 25, 52]. Therefore, in the present study, we investigate for Providencia spp. in raw milk collected from shops and vendors in Baghdad city. Our results indicate that raw milk is contaminated with P. rettgeri, P. stuartii, and P. vermicola. Providencia spp. including P. rettgeri and P. stuartii were isolated from food [9, 15–17, 53, 54]. In Iraq, out of bacterial content of fish gut, P. rettgeri reported 1/50 [55]. This is the first report of isolated Providencia from raw milk in Iraq; there is a study in Kenya, where 0.6% Providencia spp. was isolated from the milk of goats with subclinical mastitis, and 2% P. stuartii and P. alcalifacians were isolated from clinical healthy cows (subclinical mastitis) in Algeria [39, 40]. This study is also the first isolating P. vermicola from a food source such as milk. Milk may be contaminated by the environment such as soil, water, feces of the carrier or infected cattle, unhygienic conditions during milking, or used contaminated containers.

Phylogenetically, the family of Enterobacteriaceae has a highest similarity (16S rRNA gene sequence similarity), particularly with the members of genus Providencia (>98.1%), and a higher similarity 99.5% was found between P. rettgeri and P. vermicola [1]. In agreement with that found in the present study, the similarity was ranging from 99.81 to 99.9% even in used species-specific gene. In contrast, the primer Provi_foward and P_Vermi_revers primers confirmed that the two isolates were P. rettgeri (no bands), but the 3^rd one gives more one band in suspected P. vermicola. For this reason and because of the fact that the VITEK®2 system does not contain automated identification of P. vermicola in the list of card Gram negative, we used Biolog GN substrate reactions for more biochemical tests to differentiate P. vermicola from P. rettgeri such as urease, erythritol and 2-ketogluconate, L-arabinose, D-glucosaminic acid, and D-glucuronic acid reactions and depending on the cultural characterization according to [1, 41]. In addition to the sequence, results confirmed that this isolate was P. vermicola.

In the current study, the results showed multiple resistance to antibiotics with high risk, these results were similar to other research studies, and resistance against multiple antimicrobials including tetracycline, ampicillin, and streptomycin were recorded in Providencia isolates in farm animals [56]. On the other hand, MDR P. rettgeri from UTI patients recorded high resistance to amikacin, aztreonam, cephalosporins, ciprofloxacin, ertapenem, and meropenem [41]. MDR (43%) showed in Providencia spp. including P. stuartii and P. rettgeri isolated from retail meats, and most of the isolates were resistant (91%) against tetracycline, ampicillin (69%), and streptomycin (49%) [54].

In addition, the results are similar with some differences in percentage of resistance to the study in Iraq; P. alcalifaciens and P. rettgeri isolated from clinical sputum and wastewater showed a high resistance against nitrofurantoin (100%), ampicillin (94.4%), amoxicillin/clavulanic acid (72.2%), and ampicillin/sulbactam and tetracycline (38.8% and 33.3%), respectively, while resistance to imipenem and cefotaxime were 5.6% each, and the most effective antibiotics were 100% resistant to norfloxacin, chloramphenicol, and cefixim and 88.9% resistant to trimethoprim recorded by the authors in [14] which are accordance with our results. High drug resistance against chloramphenicol, trimethoprim, and tetracycline and susceptibility to streptomycin of P. vermicola were recorded in diarrheal patients [25]. Despite MDR and the risk of the Providencia spp. isolates, all the isolates were susceptible to important antimicrobials which are used clinically such as imipenem, trimethoprim, and chloramphenicol in the present study.

5. Conclusions

Our results showed that raw milk is a potential source of Providencia spp. that may lead to infection in humans and risk to public health, especially the bacteria found as MDR. The present Providencia spp. in milk may be attributed to contamination after milking from the environment such as animal feces, or it is source from subclinical mastitis cow.

6. Recommendations

More studies should be conducted for more identification of this microorganism in food and its products in Iraq. Conventional methods and commercial kits beside molecular techniques should be used to identify Providencia spp. in level species.

Data Availability

Data used to support the findings of this study can be obtained from the corresponding author on request.

Conflicts of Interest

The author declares no conflicts of interest.

Acknowledgments

The author would like to thank Dr. Nawal Dahd for helping in the laboratory to complete this research and Dr.Hanaa.

References

V. S. Somvanshi, E. Lang, B. Sträubler et al., “Providencia vermicola sp. nov., isolated from infective juveniles of the entomopathogenic nematode Steinernema thermophilum,” International Journal of Systematic and Evolutionary Microbiology, vol. 56, no. 3, pp. 629–633, 2006.
View at: Publisher Site | Google Scholar
P. Juneja and B. P. Lazzaro, “Providencia sneebia sp. nov. and Providencia burhodogranariea sp. nov., isolated from wild Drosophila melanogaster,” International Journal of Systematic and Evolutionary Microbiology, vol. 59, no. 5, pp. 1108–1111, 2009.
View at: Publisher Site | Google Scholar
S. Khunthongpan, P. Sumpavapol, S. Tanasupawat, S. Benjakul, and A. H. Kittikun, “Providencia thailandensis sp. nov., isolated from seafood processing wastewater,” The Journal of General and Applied Microbiology, vol. 59, no. 3, pp. 185–190, 2013.
View at: Publisher Site | Google Scholar
J. Jneid, S. Benamar, I. Pagnier, P. Y. Levy, J. P. Lavigne, and B. La Scolaa, “Draft genome sequence of Providencia heimbachae, isolated from a diabetic foot ulcer,” Genome. Announc, vol. 4, no. 2, pp. e00276–16, 2016.
View at: Publisher Site | Google Scholar
P. R. Krake and N. Tandon, “Infective endocarditis due to Providencia stuartii,” Southern Medical Journal, vol. 97, no. 10, pp. 1022-1023, 2004.
View at: Publisher Site | Google Scholar
M. Yoh, J. Matsuyama, M. Ohnishi et al., “Importance of Providencia species as a major cause of travellers' diarrhoea,” Journal of Medical Microbiology, vol. 54, no. 11, pp. 1077–1082, 2005.
View at: Publisher Site | Google Scholar
A. F. Koreishi, B. A. Schechter, and C. L. Karp, “Ocular infections caused by Providencia rettgeri,” Ophthalmology, vol. 113, no. 8, pp. 1463–1466, 2006.
View at: Publisher Site | Google Scholar
D. Sharma, P. Sharma, and P. Soni, “First case report of Providencia Rettgeri neonatal sepsis,” BMC Research Notes, vol. 10, no. 1, pp. 1–3, ‏2017.
View at: Google Scholar
A. Shima, A. Hinenoya, W. Samosornsuk, S. Samosornsuk, N. Mungkornkaew, and S. Yamasaki, “Prevalence of Providencia strains among patients with diarrhea and in retail meats in Thailand,” Japanese Journal of Infectious Diseases, vol. 69, no. 4, pp. 323–325, 2016.
View at: Publisher Site | Google Scholar
N. Sharma and D. Gupta, “Molecular characterization and antibiotic screening of Providencia stuartii isolated from the desert of Bikaner, northern India,” Journal of Biotechnology and Biosafety, vol. 4, no. 1, pp. 339–344, 2016.
View at: Google Scholar
A. Nahar, M. Marzan, M. Siddiquee, S. Nahar, K. S. Anwar, and S. Islam, “Multidrug resistant Providencia stuartii in chicken droppings: public health implications for poultry workers and associated communities in nearby Dhaka Metropolis, Bangladesh,” Microbiology Research Journal International, vol. 14, no. 5, pp. 1–9, 2016.
View at: Publisher Site | Google Scholar
D. Kuczynski, “Occurrence of pathogenic bacteria in surface water of an urban river in Argentina ,Reconquista River, Buenos Aires,” International Journalof Aquatic Science, vol. 7, no. 1, pp. 30–38, 2016.
View at: Google Scholar
N. M. B. Rodrigues, G. F. Bronzato, G. S. Santiago et al., “The Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) identification versus biochemical tests: a study with enterobacteria from a dairy cattle environment,” Brazilian Journal of Microbiology, vol. 48, no. 1, pp. 132–138, 2017.
View at: Publisher Site | Google Scholar
F. S. A. Al-Mayahi and R. H. Ali, “Preliminary study of emergence MDR of Providenci spp.isolates producing ESBL, AmpC and MBL among patients with RTI and Wastewater in Al-Diwaniya city,Iraq,” Biochemical and Cellular Archives, vol. 18, no. Supplement 1, pp. 1357–1368, 2018.
View at: Google Scholar
A. A. Akinyemi, O. O. Oyelakin, and A. R. Oloyede, Gene Sequencing and Sensitivity of Bacteria in Tilapia Zilli from Ijaka-Oke Location on Yewa River, Aquaculture .America, Honolulu, HI, USA, 2017.
O. O. Oyelakin, A. A. Akinyemi, J. K. Ekelemu, A. R. Oloyede, and B. O. Abiona, “Molecular characterization and haemolysis of bacteria associated with Tilapia zilli from Ijaka-Oke location on Yewa river,” Journal of Experimental Agriculture International, vol. 11, no. 6, pp. 1–7, 2016.
View at: Publisher Site | Google Scholar
O. O. Ololade, O. O. Oyelakin, A. R. Oloyede, A. A. Idowu, A. AAkinyemi, and Y. A. Babarinde, “Gene sequencing and haemolysis of bacteria in Clarias gariepinus from Ajilete location on Yewa river,” Annual Research & Review in Biology, vol. 10, no. 4, pp. 1–8, 2016.
View at: Publisher Site | Google Scholar
D. H. Bergey and J. G. Holt, Bergey’s Manual of Determinative Bacteriology, Williams and Wilkins, Baltimore, Maryland, 9th edition, 1994.
E. Koneman, C. W. Washington, D. L. Stephen et al., Color Atlas and Textbook of Diagnostic Microbiology, Lippincott, Philadelphia, PA, 5th edition, 1997.
G. Wauters, A. Boel, G. P. Voorn et al., “Evaluation of a new identification system, Crystal Enteric/Non-Fermenter, for gram-negative bacillification system, Crystal Enteric/Non-Fermenter, for gram-negative bacilli,” Journal of Clinical Microbiology, vol. 33, no. 4, pp. 845–849, 1995.
View at: Publisher Site | Google Scholar
C. M. O’Hara, F. C. Tenover, and J. M. Miller, “Parallel comparison of accuracy of API 20E, Vitek GNI, MicroScan Walk/Away Rapid ID, and Becton Dickinson Cobas Micro ID-E/NF for identification of members of the family Enterobacteriaceae and common gram-negative, non-glucosefermenting bacilli,” Journal of Clinical Microbiology, vol. 31, pp. 3165–3169, 1993.
View at: Google Scholar
C. M. O’Hara, G. L. Westbrook, and J. M. Miller, “Evaluation of Vitek GNI+ and Becton Dickinson Microbiology Systems Crystal E/NF identification systems for identification of members of the family Enterobacteriaceae and other gram-negative, glucose-fermenting and non-glucose-fermenting bacilli,” Journal of Clinical Microbiology, vol. 35, no. 12, pp. pp3269–3273, 1997.
View at: Publisher Site | Google Scholar
S. Bascomb, S. L. Abbott, J. D. Bobolis et al., “Multicenter evaluation of the MicroScan rapid gram-negative identification type 3 panel,” Journal of Clinical Microbiology, vol. 35, no. 10, pp. 2531–2536, 1997.
View at: Publisher Site | Google Scholar
S. Pignato, G. M. Giammanco, F. Grimont, P. A. D. Grimont, and G. Giammanco, “Molecular characterization of the GeneraProteus, Morganella, andProvidencia by ribotyping,” Journal of Clinical Microbiology, vol. 37, no. 9, pp. 2840–2847, 1999.
View at: Publisher Site | Google Scholar
N. Rajpara, B. M. Kutar, R. Sinha et al., “Role of integrons, plasmids and SXT elements in multidrug resistance of Vibrio cholerae and Providencia vermicola obtained from a clinical isolate of diarrhea,” Frontiers in Microbiology, vol. 6, p. 57, 2015.
View at: Publisher Site | Google Scholar
G. Godebo, G. Kibru, and H. Tassew, “Multidrug-resistant bacterial isolates in infected wounds at jimma university specialized hospital, Ethiopia,” Annals of Clinical Microbiology and Antimicrobials, vol. 12, no. 1, p. 17, 2013.
View at: Publisher Site | Google Scholar
I. Linhares, T. Raposo, A. Rodrigues, and A. Almeida, “Frequency and antimicrobial resistance patterns of bacteria implicated in community urinary tract infections: a ten-year surveillance study (2000-2009),” BMC Infectious Diseases, vol. 13, no. 1, p. 19, 2013.
View at: Publisher Site | Google Scholar
D. R. Kadavy, J. M. Hornby, T. Hawarkost, K. W. Nickerson, and W. N. Kenneth, “Natural antibiotic resistance of bacteria isolated from larvae of the oil fly, helaeomyia petrolei,” Applied and Environmental Microbiology, vol. 66, no. 11, pp. 4615–4619, 2000.
View at: Publisher Site | Google Scholar
S. Shin, S. H. Jeong, H. Lee, J. S. Hong, M. J. Park, and W. Song, “Emergence of multidrug-resistant Providencia rettgeri isolates co-producing NDM-1 carbapenemase and PER-1 extended-spectrum β-lactamase causing a first outbreak in Korea,” Annals of Clinical Microbiology and Antimicrobials, vol. 17, no. 1, 20 pages, 2018.
View at: Publisher Site | Google Scholar
H. Barrios, U. Garza-Ramos, F. Reyna-Flores et al., “Isolation of carbapenem-resistant NDM-1-positive Providencia rettgeri in Mexico,” Journal of Antimicrobial Chemotherapy, vol. 68, no. 8, pp. 1934–1936, 2013.
View at: Publisher Site | Google Scholar
M. Abdallah, R. Alhababi, N. Alqudah, B. Aldyyat, and A. Alharthy, “First report of carbapenem-resistant Providencia stuartii in Saudi Arabia,” New Microbes and New Infections, vol. 26, pp. 107–109, 2018.
View at: Publisher Site | Google Scholar
V. S. Tshisevhe, M. R. Lekalakala, N. Tshuma, S. Janse van Rensburg, and N. Mbelle, “Outbreak of carbapenem-resistant Providencia rettgeri in a tertiary hospital,” South African Medical Journal, vol. 107, no. 1, pp. 31–33, 2017.
View at: Google Scholar
S. Marjan, K. K. Das, S. K. Munshi, and N. Noor, “Drug-resistant bacterial pathogens in milk and some milk products,” Nutrition and Food Science, vol. 44, no. 3, pp. 241–244, 2014.
View at: Publisher Site | Google Scholar
M. Aebi, B. Van Den Borne, A. Raemy, A. Steiner, P. Pilo, and M. Bodmer, “Mycoplasma bovis infections in Swiss dairy cattle: a clinical investigation,” Acta Veterinaria Scandinavica, vol. 57, no. 1, p. 10, 2015.
View at: Publisher Site | Google Scholar
M. Hamiroune, A. Berber, and S. Boubekeur, “Contribution to the study of staphylococcus contamination of cows' milk on a number of farms in Algiers: its impact on human health,” Revue Scientifique Et Technique, vol. 33, no. 3, pp. 1035–1041, 2014.
View at: Publisher Site | Google Scholar
F. F. Guimarães, D. B. Nóbrega, V. B. Richini-Pereira, P. M. Marson, J. C. De Figueiredo Pantoja, and H. Langoni, “Enterotoxin genes in coagulase-negative and coagulase-positive staphylococci isolated from bovine milk,” Journal of Dairy Science, vol. 96, no. 5, pp. 2866–2872, 2013.
View at: Google Scholar
I. Verdier-Metz, G. Gagne, S. Bornes et al., “Cow teat skin, a potential source of diverse microbial populations for cheese production,” Applied and Environmental Microbiology, vol. 78, no. 2, pp. 326–333, 2012.
View at: Publisher Site | Google Scholar
M. Vacheyrou, A.-C. Normand, P. Guyot, C. Cassagne, R. Piarroux, and Y. Bouton, “Cultivable microbial communities in raw cow milk and potential transfers from stables of sixteen French farms,” International Journal of Food Microbiology, vol. 146, no. 3, pp. 253–262, 2011.
View at: Publisher Site | Google Scholar
P. Mahlangu, M. Naomi, and K. John, “Prevalence, risk factors, and antibiogram of bacteria isolated from milk of goats with subclinical mastitis in thika east subcounty, Kenya,” Journal of Veterinary Medicine, vol. 2018, Article ID 3801479, 8 pages, 2018.
View at: Publisher Site | Google Scholar
R. Saidi, D. Khelef, and R. Kaidi, “Bovine mastitis: prevalence of bacterial pathogens and evaluation of early screening test,” African Journal of Microbiology Research, vol. 7, no. 9, pp. 777–782, 2013.
View at: Google Scholar
Y. Yi, H. W. Park, S. Shrestha et al., “Identification of two entomopathogenic bacteria from a nematode pathogenic to the oriental beetle, Blitopertha orientalis,” Journal of Microbiology and Biotechnology, vol. 17, no. 6, p. 968, 2007.
View at: Google Scholar
S. Mukherjee, D. Kumar, A. K. Nanda, and R. Chakraborty, “16S rRNA gene sequence analyses of the metagenome derived from waters of river Mahananda at Siliguri: an approach to understand bacterial diversity,” Indian Journal of Biotechnology, vol. 12, pp. 80–88, 2013.
View at: Google Scholar
CLSI (Clinical and Laboratory Standards Institute), Performance Standards for Antimicrobial Susceptibility Testing, Twenty-Fourth Informational Supplement. CLSI Document M100, Wayne, PA, 29th edition, 2019.
EUCAST (The European Committee on Antimicrobial Susceptibility Testing), Disk Diffusion Method for Antimicrobial Susceptibility Testing,Version 7.0, http://www.eucast.org.2019.
A. P. Magiorakos, A. Srinivasan, R. B. Carey et al., “Multidrugresistant, extensively drug-resistant and pan drug resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance,” Clinical Microbiology and Infection, vol. 18, no. 3, pp. 268–281, 2012.
View at: Publisher Site | Google Scholar
P. H. Krumperman, “Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods,” Applied and Environmental Microbiology, vol. 46, no. 1, pp. 165–170, 1983.
View at: Publisher Site | Google Scholar
G. Cornaglia, S. Frugoni, A. Mazzariol, E. Piacentini, A. Berlusconi, and R. Fontana, “Activities of oral antibiotics on Providencia strains isolated from institutionalized elderly patients with urinary tract infections,” Antimicrobial Agents and Chemotherapy, vol. 39, no. 12, pp. 2819–2821, 1995.
View at: Publisher Site | Google Scholar
K. Cui, X. Fu, Z. Li, and C. Li, “An investigation into food poisoning caused by Providencia rettgeri,” Litetural Infections Preventive Medicine, vol. 6, p. 116, 2000.
View at: Google Scholar
R. Chlibek, J. Jirous, and J. Beran, “Diarrhea outbreak among Czech Army Field Hospital personnel caused by Providencia alcalifaciens,” Journal of Travel Medicine, vol. 9, pp. 151-152, 2002.
View at: Google Scholar
S. Mahrouki, H. Chihi, A. Bourouis, M. Ben Moussa, and O. Belhadj, “First characterization of a Providencia stuartii clinical isolate from a Tunisian intensive care unit coproducing VEB-1-a, OXA-2, qnrA6 and aac(6′)-Ib-cr determinants,” Brazilian Journal of Infectious Diseases, vol. 18, no. 1, pp. 211–214, 2014.
View at: Publisher Site | Google Scholar
A. Shima, A. Hinenoya, M. Asakura, A. Nagita, and S. Yamasaki, “Prevalence of Providencia strains among children with diarrhea in Japan,” Japanese Journal of Infectious Diseases, vol. 65, no. 6, pp. 545–547, 2012.
View at: Publisher Site | Google Scholar
R. Ramkumar, M. Ravi, C. Jayaseelan, A. Abdul Rahuman, C. Anandhi, and P. Perumal, “Description of Providencia vermicola isolated from diseased Indian major carp, Labeo rohita (Hamilton, 1822),” Aquaculture, vol. 420-421, pp. 193–197, 2014.
View at: Publisher Site | Google Scholar
M. M. Shah, E. Odoyo, P. S. Larson et al., “First report of a foodborne Providencia alcalifaciens outbreak in Kenya,” Journal of Tropical Medicine and Hygiene, vol. 93, no. 3, pp. 497–500, 2015.
View at: Publisher Site | Google Scholar
H. Di, S. Liang, Q. Li et al., “Providencia in retail meats from Guangzhou, China and Osaka, Japan: prevalence, antimicrobial resistance and characterization of classes 1, 2 and 3 integrons,” Journal of Veterinary Medical Science, vol. 80, no. 5, pp. 829–835, 2018.
View at: Publisher Site | Google Scholar
N. W. Hammood and I. A. J. Ibrahim, “Bacterial content in gut for different species of fish collecting from tigris river in Baghdad city, Iraq,” Tikrit Journal of Pure Science, vol. 23, no. 3, pp. 33–37, 2015.
View at: Google Scholar
I. E. Aibinu, Y. Pfeifer, F. Ogunsola, T. Odugbemi, W. Koenig, and B. Ghebremedhin, “Emergence of β-lactamases OXA-10, VEB-1 and CMY in Providencia spp. from Nigeria,” Journal of Antimicrobial Chemotherapy, vol. 66, no. 8, pp. 1931-1932, 2011.
View at: Google Scholar

Copyright

Copyright © 2020 Nagham Mohammed Ayyal Al‐Gburi. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

2181

Downloads

1051

Citations