Veterinary Medicine International / 2023 / Article / Tab 1 / Research Article
Extender Supplementation with Glutathione (GSH) and Taurine Improves In Vitro Sperm Quality and Antioxidant Status of New Zealand Rabbits during Chilled Storage for up to 72 hours Table 1 Primer sequences and annealing temperature.
Gene Primer Annealing Slope Efficiency Reference SOD F: CCCGGTCTTTGTACTCTCGT 60°C + preheating (at 62°C for 1 min) −3.34 99.25 [46 ] NM_001082627 R: AAGGATGAAGAGAGGCACGT CAT F: GCCCTGGTCAGTCTTGTAGT 62°C −3.42 96.06 [46 ] XM_002709045 R: CCATCGGCATATGAACGGAT GAPDH F: ATCTCGCTCCTGGAAGATGG 60°C + preheating (at 62°C for 1 min) −3.39 97.24 [46 ] NM_001082253 R: CAAAGTGGATGTTGTCGCCA
SOD = superoxide dismutase; CAT = catalase; GAPDH = glyceraldehyde-3-phosphate dehydrogenase (reference gene).